Taq polymerase

We used Plant Genomic DNA Kit (TianGen Biotech, Xi’an, China) to extract DNA from silica-gel dried leaves. ITS-1 and ITS-4 (Mayuzumi and Ohba, 2004 (link)) primers were used for amplifying ITS, c and f (Taberlet et al., 1991 (link)) for trnL-F, and trnS and trnG for trnS-G (Hamilton, 1999 (link)). Polymerase Chain Reaction (PCR) mixture were 20 μl with 2 μl 10× buffer, 0.5 μl of each primer, 0.4 μl of dNTP mixture, 1 U of Taq polymerase (TianGen Biotech, Xi’an, China) and 1 μl template genomic DNA. The PCR cycling programs followed Liu P.L.et al. (2012) (link). The same amplification primers were used for sequencing of the chloroplast fragments and most ITS sequences. For individuals that have multiple peaks, we ligated the PCR products into pGEM-T Easy Vector using a Promega Kit (Promega Corporation, Madison, WI, United States). Then we chose plasmid that containing the right insertion to sequence. Sequencing was conducted on a 3730 automatic DNA sequencer in Tsingke Biotech, Xi’an, China. We used ContigExpress (a component of Vector NTI Suite 6.0, InforMax) to check and assemble contigs, and ClustalW v 1.7 (Thompson et al., 1994 (link)) to align the sequences. Finally, we manually checked the aligned matrix in BioEdit v 7.0.1.

Rice genomic DNA was extracted by using a DNA Quick Plant System (TransGen Biotech, Beijing, China). 50 ng of genomic DNA were used as a template to perform PCR amplification using Taq polymerase (Tiangen, Beijing, China). The primer sets RC11-F/RC11-R and RC33-F/RC33-R were designed to flank the designated target sites. The PCR products amplified by the primer sets RC11-F/RC11-R and RC33-F/RC33-R were digested with Cac8 I and Dde I, respectively. Then the undigested band was recovered and directly sequenced to screen for the plants with mutations in SBEI or SBEIIb. The sequence chromatograms were analyzed by a web-based tool¹ to check the genotype and zygosity of the tested plants. PCR products were also cloned into the TA cloning vector P-easy (TransGen Biotech, Beijing, China), and 10 positive colonies were sequenced for each sample. The PCR primer sets used for the PCR/RE assay and detection of the presence of Cas9 and gRNA were as listed in Supplementary Table S2. T₁ homozygous sbeI and sbeIIb mutant lines derived from either T₀ homozygotes or bi-allelic lines were subjected to further analyses.

Genomic DNA was isolated from young leaves using the CTAB method[28 (link)]. PLUG primers were designed as described by Ishikawa et al. [29 (link)]. PCR was conducted using a T100^TM Thermal cycler (Bio-RAD Laboratories, Emeryville, CA, USA) in a 25 μL reaction mixture, containing 2.5 μL of 10× buffer (50 mM KCl, 1.5 mM MgCl₂, and 10 mM Tris-HCl, pH 8.3), 200 nmol of each dNTP, 100 ng of genomic DNA, 0.2 U of Taq polymerase (TianGen, Beijing, China) and 400 nmol of each primer. The amplification protocol as follows: initial denaturation at 94°C for 3 min; followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C (dependent on different primer sets) for 1 min, extension at 72°C for 2 min, and final extension at 72°C for 10 min. The PCR products were separated on 2% (w/v) agarose gels, and visualized by EtBr staining.

DNA was extracted from silica-gel dried leaves with a Plant Genomic DNA Kit (TianGen Biotech, Beijing, China). The amplification primers used for ITS were ITS-1 and ITS-4 [52] , for trnL-F were c and f [54] (link) and for trnS-G were trnS and trnG [55] (link). Polymerase Chain Reaction (PCR) was performed in 20 µl reaction mixture volumes containing 2 µl 10× buffer, 0.5 µl of each primer, 0.4 µl of dNTP mixture, 1 U of Taq polymerase (TianGen Biotech, Beijing, China) and 1 µl template genomic DNA. The PCR cycling programs followed Liu et al. [56] . Direct sequencing was conducted for the pDNA fragments using the same primers as for the amplification. Most of the ITS samples were also directly sequenced, although a few of them were ligated onto pGEM-T Easy Vector using a Promega Kit (Promega Corporation, Madison, WI, USA). Plasmids containing the right insertion were chosen for sequencing reactions. All sequencing was conducted with a 3730 automatic DNA sequencer by Biomed Biotech, Beijing, China. Contigs were edited and assembled using ContigExpress (a component of Vector NTI Suite 6.0, InforMax). Sequence alignment was mostly done using ClustalW version 1.7 [57] (link) and checked by eye in BioEdit version 7.0.1.

Total DNA was extracted from 500 mg of soil using the FastDNA SPIN Kit for Soil (MP Biomedical, USA) according to the manufacturer’s protocol, with a final elution in 50 μL MQ water. DNA concentration and quality were assessed based on spectral absorbance at 260-nm wavelength and absorbance ratios of 260/280 nm and 260/230 nm, respectively, using a NanoVue Plus Spectrophotometer (GE, USA). DNA was stored at −20 °C until ready for PCR and real-time PCR. PCR amplifications of Archaeal and Bacterial 16S rDNA and amoA genes were performed directly from extracted DNA, using general primers (Table 4). Each 25 μL PCR mixture contained 1.25 U Taq polymerase (Tiangen, Beijing, China), 500 μM dNTP each, 20 mM Tris-HCl (pH 8.3), 100 mM KCl, 3 mM MgCl₂, 0.4 μM of each primer and PCR-enhancing substances. For 16S rDNA, the following protocol was followed: 95 °C for 5 min; 35 cycles consisting of 94 °C for 60 s, 55 °C for 60 s, and 72 °C for 90 s; and 72 °C for 10 min. For the amoA gene, the following protocol was used: 95 °C for 5 min; 30 cycles consisting of 94 °C for 45 s, 50 °C for 45 s, and 72 °C for 60 s; and 72 °C for 10 min. Triplicate PCR products were pooled (to minimize PCR bias) and gel-purified using the Agarose Gel DNA Fragment Recovery Kit Ver. 2.0 (TaKaRa, Dalian, China). The resulting PCR product quantities were determined by measuring absorbance at 260 nm.

Genomic DNA was extracted from cells and paraffin‐embedded sections using a DNA extraction kit (Axygen, Union City, CA, USA). For each sample, the genotype of LAPTM4B was identified by PCR using the following primers: 5′‐GCCGACTAGGGGACTGGCGGA‐3′ (P1 forward) and 5′‐CGAGAGCTCCGAGCTTCTGCC‐3′ (P2 reverse). The PCR mixture (25 μL) contained 0.5 U Taq polymerase (TIANGEN, Beijing, China) and 1 μL template DNA at a final concentration of 100 ng·μL⁻¹. Human β‐actin was used as an internal positive control using the following primers: 5‐TCACCAACTGGGACGACAT‐3 (forward), 5‐AGGTAGTCAGTCAGGTCCCG‐3 (reverse). The PCR products were analysed by electrophoresis in a 2.5% agarose gel and visualized with ethidium bromide.