‘In vivo-ready’ LNAs were custom designed and ordered from Qiagen (formally Exiqon), and later by IDT. For intranasal delivery, in vivo-ready LNA was mixed in complexes with In vivo-JetPEI® transfection reagent (Polyplus) according to manufacturer’s protocol to the indicated final concentration in 50–75 μl of 5 % glucose solution. Mice were then lightly anesthetized with isoflurane and 50–75 μl of the solution was delivered intranasally. For retro-orbital delivery: ‘In vivo-ready’ LNA was mixed in complexes with In vivo-JetPEI® transfection reagent (Polyplus) according to manufacturer′s protocol to the indicated final concentration in 200 μl of 5 % glucose solution. Mice were then anesthetized, and the solution was delivered by retro-orbital injection. Oseltamivir phosphate (OSLT; Sigma Aldrich Cat. SML1606) was prepared in sterile water and administered to mice at a dose of 10 mg/kg bidaily by oral gavage (totaling 20 mg/kg/day), with 8 hours between dosing intervals.
In vivo jetpei transfection reagent
Manufactured by Polyplus Transfection
Sourced in United States
In vivo-jetPEI is a transfection reagent designed for in vivo nucleic acid delivery. It is a cationic polymer that forms complexes with nucleic acids, facilitating their uptake by cells.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using in vivo jetpei transfection reagent
1
Intranasal and Retro-Orbital Delivery of LNA
2
Murine Melanoma Model: Subcutaneous Implantation and Intratumoral Therapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B16F10 cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. Pathogen-free C57BL/6 mice were purchased from HFK Bioscience Co., Ltd. (Beijing, China). Experiments were performed according to the guidelines approved by the Committee on the Ethics of Animal Experiments of Shandong University. Injected subcutaneously were 5 × 105 B16F10 cells into the right flank of C57BL/6 mice. The tumor mass was clearly identified at about 50 mm3 in size within 4 days. The mice were then intratumorally injected with dual-function, shRNA, and ssRNA vectors mixed with in vivo-jetPEI transfection reagent (Polyplus Transfection Inc., NY, USA) every 4 days, and the tumor volume was measured during 2 weeks of treatment. Tumor length and width were measured every 3 days, and the volume was calculated according to the formula (length × width2)/2.
3
RNAi Silencing of CrzR and Vg in Ants
4
Mouse Xenograft Model for siRNA Therapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT116 cells (1.0 × 107) were injected subcutaneously into the right flank of 4-week-old male BALB/c nude mice (Experimental Animal Centre of SIBS, Shanghai, China). After the tumours grew to 5 mm in diameter, the mice were randomly allocated (six mice per group) and treated with multipoint intratumoural injection (10 μg per 30 μl per tumour) of siRNA complexed with in vivo-jetPEI transfection reagent (Polyplus-transfection Inc., New York, NY, USA) every other day for 11 days. Tumour volume (mm3) was estimated using the formula: tumour volume (mm3)=smallest diameter2 × largest diameter/2. The tumour volume data are presented as means±s.d. The Institutional Animal Care and Use Committee approved all experimental procedures.
5
Athymic Mouse Xenograft Model for RCN1 Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BALB/c athymic (nu+/nu+) male mice, aged 5‐6 weeks, were purchased from the Animal Center of China Academy of Medical Sciences (Beijing, China). The research protocol complied strictly with the institutional guidelines of the Animal Care and Use Committee at Shandong University. DU145 cells (1 × 107) were injected into the left upper flank of the mouse. Three months later, tumor tissue from the mouse was inoculated into the right armpits of other mice. After the tumors grew to 5 mm in diameter, the mice were randomly assigned to different groups (n = 7) and treated with multipoint intra‐tumoral injections of siRCN1 (10 μg/30 μL/tumor) complexed with the in vivo‐jetPEI transfection reagent (Polyplus‐transfection NY, USA) every other day for 15 days. Tumor sizes were monitored daily by measuring the length (L) and width (W) using calipers, and tumor volume (V) was calculated according to the formula V = (L × W2) × 0.5.
6
Alpaca Immunization with ANDV-GPC Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three outbred male alpacas (Vicugna pacos), roughly 80 kg in size, were procured from a local supplier and housed at the Vaccine and Infectious Disease Organization (VIDO) in Saskatoon, Saskatchewan, Canada. Alpacas were immunized with pCAGGS-ANDV-GPC via intradermal injections. Briefly, 0.5 mg of expression plasmid was mixed with 160 µl of Invivo-Jet PEI transfection reagent (Polyplus Transfection) without an adjuvant and delivered into 8 sites (approximately 250 µl per site) in the neck at 3 week intervals (immunization dose was 1 mg per time point; total immunogen delivered was 4 mg pCAGGS-ANDV-GPC). Blood samples were collected on days 0 (100 ml), 21, 42, 63 (10 ml per time point), 66 (100 ml), and 84 (10 ml) and separated into plasma fractions for determination of neutralizing antibody titers. Based on these results, blood samples were collected immediately prior to further boosts at days 228 (100 ml blood draw) and 249 (100 ml blood draw) post-initial immunization. Boosts were conducted as outlined above with the exception that the single low-responding animal was boosted via intramuscular injections. A final blood draw (100 ml) occurred at day 270 for purification and subsequent animal studies.
7
Subcutaneous Xenograft Model for siRNA Therapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four- to six-week-old male Balb/c mice (MARC, Nanjing University, Nanjing, China) were housed under specific pathogen-free conditions and cared for in accordance with protocols approved by the Experimental Animal Care Commission in China Pharmaceutical University. SMMC-7721 cells (1.0 × 106) were injected subcutaneously into the right flank of mice. When the volume of tumors reached about 100 mm3, mice were randomly allocated (six mice per group) and treated with multipoint intratumoral injection of siRNA (10 μg per tumor) complexed with in vivo-jetPEI transfection reagent (Polyplus-transfection Inc., New York, NY, USA) every other day. Tumor volumes were monitored throughout the experiment. Mice were sacrificed after 2 weeks of treatment, tumors were removed, photographed, and processed for immunohistochemical and western blot analysis.
8
Intrathecal siRNA Knockdown of OAT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cocktail of four small interfering RNAs (siRNAs) targeting OAT1 (Slc22a6) or negative control siRNA (Qiagen) were intrathecally delivered using the in vivo-jetPEI® transfection reagent (Polyplus transfection) according to the manufacturer’s instructions and established protocols86 (link). siRNAs were intrathecally delivered once per day for three consecutive days. The following sequences were used: Slc22a6: AAGGAACTGACTCTAAACAAA (SI01420783), TCGGAAGGTGCTGATCTTGAA (SI01420790), ATCCTAGTGAATGGCATAATA (SI01420797), CCCAGACAATTAAATAAATTT (SI01420804), and, as a negative control, AATTCTCCGAACGTGTCACGT (1022076).
9
Intracranial Injection of Glioblastoma Cells in Nude Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five-week-old male nude mice (BioLASCO) were intracranially injected with 5 × 10 5 U-87 MG/Luc cells in 5 ml of growth medium. The tumor cell injection was performed at the position 0.5 mm to the right of the bregma, 2.5 mm posterior to the bregma, and 4 mm below the skull surface. Control or IGFBP3 siRNAs of 1.5 mg/mouse were mixed with in vivo jetPEI transfection reagent (Polyplustransfection) according to the manufacturer's instruction and infused into tumors using the convection-enhanced delivery (CED) method. Briefly, mice were anesthetized with inhalational anesthetic isoflurane (Forane, AbbVie Limited) and placed on a mouse stereotaxic instrument with continuous supplement of isoflurane. CED procedures were performed with a UMP3 microinjection system (UMC4 pump controller and UMP3 pump, World Precision Instruments) and a 100-ml NANOFIL-100 syringe (World Precision Instruments) with a 26G needle at an infusion rate of 1 ml/min. After infusion of 5 ml siRNA and in vivo jetPEI mixture, the cannula was left in the tissue for 10 minutes to prevent reflux. The weights of the mice and tumor sizes, determined by the Xenogen IVIS 100 In Vivo Imaging System, were measured twice a week. Mice were euthanized when they lost 20% weight or became weak and unable to perform normal living functions. The brains of mice were excised for further analyses.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!