Sh800 cell sorter

Manufactured by Sony

Sourced in Japan, United States, United Kingdom

The SH800 cell sorter is a laboratory instrument designed for high-performance cell sorting. It is capable of accurately and efficiently sorting cells based on their physical and fluorescent properties.

Automatically generated - may contain errors

Lab products found in correlation

Propidium iodide, by Merck Group (7 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions) Aldefluor kit, by STEMCELL (4 mentions) Sa3800 spectral cell analyzer, by Sony (4 mentions) Glutamax, by Thermo Fisher Scientific (4 mentions) Accutase, by Thermo Fisher Scientific (4 mentions) Sh800, by Sony (3 mentions) Streptavidin pe, by BioLegend (3 mentions) Percoll, by GE Healthcare (3 mentions) Trypsin edta, by Thermo Fisher Scientific (3 mentions) Rnase a, by Merck Group (3 mentions) Rlt buffer, by Qiagen (3 mentions) Facscanto 2, by BD (3 mentions) Trypsin, by Thermo Fisher Scientific (3 mentions) Anti cd16 32 antibody, by BD (3 mentions) Accutase, by Nacalai Tesque (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Perm wash buffer, by BD (2 mentions) G418 solution, by Roche (2 mentions)

Spelling variants of this product

SH800 (275 citations) SH800S Cell Sorter (200 citations) SH800 sorter (47 citations) SH800S sorter (15 citations) Sony LE-SH800 cell sorter (8 citations) SH800 FACS Cell Sorter (3 citations) SH800S Cell Sorter cytometer (2 citations) SH800S Cell Sorter flow cytometer (2 citations) Cell Sorter Model SH800S (2 citations) SH800 cell sorter system (2 citations)

344 protocols using sh800 cell sorter

Generation of TLR Reporter Cell Lines

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Retroviral expression constructs coding for TLR4, MD-2 and CD14 were described before (41 (link)). TLR4, MD-2 and CD14 were simultaneously transduced into TLR non-responder cells. Positive eGFP-expressing cells were sorted after stimulation with LPS (300 ng/mL) for 24 h using a Sony SH800 cell sorter. Single cell clones were established by limiting dilution culturing.
Sequences encoding human TLR2 and TLR1 were cloned into the retroviral expression vector pCJK2 (45 (link)). The TLR2 construct was expressed in TLR non-responder cells and TLR2-expressing cells were sorted on a Sony SH800 cell sorter using an AlexaFluor647-coupled anti-human CD282 (TLR2) antibody (BD Biosciences). Single cell clones were established and a clone with high reactivity towards Fsl-1 (TLR2/6 ligand) was chosen as TLR2/6 reporter cell line. Into the TLR2-positive sorted cell pool, TLR1 was transduced to establish TLR2/1/6 reporter cells. Cells were sorted for reactivity against Pam3CSK4 (TLR2/1 ligand) by sorting eGFP-expressing cells after activation with 100 nM Pam3CSK4 for 24 h on a Sony SH800 cell sorter. Single cell clones were established and a clone with high reactivity towards Fsl-1 (TLR2/6 ligand) and Pam3CSK4 (TLR2/1 ligand) was chosen as TLR2/1/6 reporter cell line.

Radakovics K., Battin C., Leitner J., Geiselhart S., Paster W., Stöckl J., Hoffmann-Sommergruber K, & Steinberger P. (2022). A Highly Sensitive Cell-Based TLR Reporter Platform for the Specific Detection of Bacterial TLR Ligands. Frontiers in Immunology, 12, 817604.

+ Open protocol

+ Expand

Flow Cytometry Analysis of Cell Surface Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of surface proteins on cultured cells was measured with flow cytometry. Tumor cells were harvested upon incubation with Accutase (Nacalai Tesque). Cells were stained using CD133/1 (AC133) conjugated to allophycocyanin (APC; 130-090-826; Miltenyi Biotec, Auburn, CA) and CD44 conjugated to APC/Fire750 (33817; BioLegend, San Diego, CA). Relative fluorescent intensities were measured using an SH800 cell sorter (SONY, Tokyo, Japan). Single cells were sorted using an SH800 cell sorter (SONY). Data were analyzed with FlowJo 10.2 software (FlowJo LLC, Ashland, OR, USA).

Fujino S, & Miyoshi N. (2019). Oct4 Gene Expression in Primary Colorectal Cancer Promotes Liver Metastasis. Stem Cells International, 2019, 7896524.

+ Open protocol

+ Expand

CRISPR-Mediated Genetic Knockout in THP-1 and iBMDM Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

sgRNAs were designed with CHOPCHOP or CRISPick, while other sgRNAs were picked based on data in the literature (Table S15). Oligos containing desired sgRNA sequences were annealed and assembled into the appropriate vector with the Golden Gate cloning protocols provided by the Zhang lab.
Bulk knockouts in THP-1 cells expressing lentiCRISPRv2-puro were selected with puromycin (2.5 μg/mL, 7 d), recovered (3–6 d), and immediately used for experiments. Bulk knockouts in THP-1s expressing lentiCRISPRV2-mCherry were sorted for mCherry-positive cells (using the parental line as a negative control) with a Sony SH800 Cell Sorter operating in purity mode. For each sorted cell line, 100,000 cells were obtained and expanded for experiments within 7 d. Cell pellets for western blots were taken on the same day as cells were plated for inflammasome assays. For clonal iBMDMs spinfected with lentiCRISPRv2-puro vectors, cells were selected with puromycin (5 μg/mL, 7 d) then single-cell cloned into 96-well dishes with a Sony SH800 Cell Sorter operating in single-cell mode. Clonal knockouts were first validated at the genomic level with Miseq using OutKnocker 2.0 [187 (link)] to align gDNA reads (see Table S15 for genomic primers). Subsequently, knockouts were validated at the protein level by Western Blot or immunofluorescence.

Hollingsworth L.R., Veeraraghavan P., Paulo J.A., Harper J.W, & Rauch I. (2024). Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. bioRxiv.

+ Open protocol

+ Expand

Cell Cycle Analysis of Synchronized Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were synchronized at the G₁ phase of the cell cycle by serum starvation for 96 hours and restimulated by changing medium containing 10% FBS as previously described.²¹ The restimulated cells were harvested, washed with PBS, and fixed in 70% ethanol at −20℃. The fixed cells were incubated in 0.25 mg/mL RNase for 30 minutes at 37℃. Samples were then washed with PBS and stained with propidium iodide (Sigma‐Aldrich). The cell cycle distribution was measured on an SH800 cell sorter (Sony Biotechnology).
An EdU assay was carried out using GET4 KO cells and WT cells in the medium containing 10% FBS. Cells were incubated with EdU for 2 hours before harvest. EdU was detected using a Click‐iT Plus EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. The cell cycle distribution was measured on an SH800 cell sorter (Sony Biotechnology).

Koike K., Masuda T., Sato K., Fujii A., Wakiyama H., Tobo T., Takahashi J., Motomura Y., Nakano T., Saito H., Matsumoto Y., Otsu H., Takeishi K., Yonemura Y., Mimori K, & Nakagawa T. (2021). GET4 is a novel driver gene in colorectal cancer that regulates the localization of BAG6, a nucleocytoplasmic shuttling protein. Cancer Science, 113(1), 156-169.

+ Open protocol

+ Expand

Apoptosis Assay for DATS Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Annexin V-FITC Apoptosis assay Kit from RayBiotech was used to determine DATS’s ability to induce apoptosis in MDA-MB-231 and MDA-MB-468 cells. Each experiment was done in triplicate and performed as described by the manufacturer. Briefly, both cell lines were seeded at 5×10⁵ cells/well in a 6-well plate and incubated overnight. Cell-only samples were used as a negative control, while cells treated with 1 mM staurosporine were used as positive controls. DATS, TNF-α, and CoTx, as well as control samples, were brought to a final volume of 2 ml/well of experimental media to induce apoptosis. After a 72 h incubation period, cells were harvested, centrifuged, pelleted, and washed with PBS. Cell pellets were resuspended in 500 μl of 1X Annexin-V binding buffer, then 5 μl of Annexin V-FITC and propidium iodide (PI) was each added to the appropriate tube according to the manufacturer’s protocol. Finally, the apoptotic effect was quantified within 10 minutes by Sony SH800 Cell Sorter (San Jose, CA, USA). The Sony SH800 Cell Sorter was aligned with Sony SH800 and MA900 automatic setup beads, and the samples were analyzed within 1 h for data acquisition on Cell Sorter Software version 2.1.6. For each sample, 10×10³ cells were analyzed separately.

KANGA K.J., KANGA L.H., MENDONCA P., SOLIMAN K.F., FERGUSON D.T., REED S.L, & DARLING-REED S. (2023). Attenuative Effect of Diallyl Trisulfide on Caspase Activity in TNF-α-induced Triple Negative Breast Cancer Cells. Anticancer research, 43(6), 2393-2405.

+ Open protocol

+ Expand

Evaluating Luteolin's Cytoprotective Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols

PE-Annexin V/7-AAD staining was performed on HT-22 cells that were seeded in 6-well plates at a density of 100,000 cells per well and allowed to adhere for 18–24 h. The cells were pre-treated with luteolin (5 µM-25 µM) for 24 h. Following this pre-treatment, the cells were exposed to glutamate for 18 h. Subsequently, the cells were harvested from the plate, washed with PBS, and resuspended in 100 μL of 1X Annexin V binding buffer. They were then incubated in the dark at room temperature with 5 µL of PE Annexin V and 5 µL of 7-AAD viability staining solution for 15 min. Then, the cells were diluted with 400 μL of binding buffer. For each experiment, unstained and single-channel controls were used to calculate compensation. Flow cytometry analysis was performed using a Cell sorter SH800S (Sony Biotechnology, San Jose, CA, USA).

Vongthip W., Nilkhet S., Boonruang K., Sukprasansap M., Tencomnao T, & Baek S.J. (2024). Neuroprotective mechanisms of luteolin in glutamate-induced oxidative stress and autophagy-mediated neuronal cell death. Scientific Reports, 14, 7707.

+ Open protocol

+ Expand

Genome Editing Using ArciTect Cas9-eGFP

Check if the same lab product or an alternative is used in the 5 most similar protocols

For genome editing, the ArciTect Cas9-eGFP system was used according to the manufacturer’s conditions (STEMCELL Technologies, Köln, Germany). Briefly, ArciTect™ CRISPR-Cas9 RNP Complex solution was generated with 60 μM gRNA and tracrRNA and 3.6 µg ArciTect™ Cas9-eGFP Nuclease. Afterwards, 20 µM single-strand oligodeoxynucleotide (ssODN) was added to the RNP solution. The following gRNA was used to target TFR2 of HIF1α-AS1: 5ʹ-ACGTGCTCGTCTGTGTTTAG-3ʹ. The following ssODNs (Integrated DNA Technologies, Leuven, Belgium) were used to replace TFR2: MEG3, 5ʹ-GAG GCACAGCTGGGACGGGCTGCGACGCTCACGTGCTCGTCTGTGTTGTAATCGCTCCCTCTCTGCTCTCCGATGGGGGTGCGGCTCAGCCCGAGTCTGGGGACTCTGCGCCTTCTCCGAAGGAAGGCGG-3ʹ, negative control Luc 5ʹ-GCTGAGGCACAGCTGGGACGGGCTGCGACGCTCACGTGCTCGTCTGTGTTGTAATTATCACGCTCGTCGTTCGGTATGATGGGGGTGCGGCTCAGCCCGAGTCTGGGGACTCTGCGCCTTCTCCGAAGGAAG-3ʹ. 400.000 HUVECs were seeded in a 12-well plate and electroporated in E2 buffer with the NEON electroporation system (Invitrogen) (1,400 V, 1 × 30 ms pulse). A full medium exchange was done every 24 h and cells were incubated for 72 h. For FACS, eGFP-positive cells were sorted in PBS supplemented with 5% FCS with a Cell Sorter SH800S (Sony).

Leisegang M.S., Bains J.K., Seredinski S., Oo J.A., Krause N.M., Kuo C.C., Günther S., Sentürk Cetin N., Warwick T., Cao C., Boos F., Izquierdo Ponce J., Haydar S., Bednarz R., Valasarajan C., Fuhrmann D.C., Preussner J., Looso M., Pullamsetti S.S., Schulz M.H., Jonker H.R., Richter C., Rezende F., Gilsbach R., Pflüger-Müller B., Wittig I., Grummt I., Ribarska T., Costa I.G., Schwalbe H, & Brandes R.P. (2022). HIF1α-AS1 is a DNA:DNA:RNA triplex-forming lncRNA interacting with the HUSH complex. Nature Communications, 13, 6563.

+ Open protocol

+ Expand

Isolation and Culture of BEEC

Check if the same lab product or an alternative is used in the 5 most similar protocols

BEEC isolation and culture were performed according to a previously described protocol (16 (link)) with minor modifications. Cells were primed with pre-ovulatory levels of estradiol (E2) (1 ng ml⁻¹) and progesterone (P4) (50 pg ml⁻¹) until reaching confluence. Confluence and intact integrity were determined using area fraction (AF) output based on cellular translucence and boundaries (ImageJ software Version1.51j8). Epithelial cell purity >98% was evaluated using a monoclonal antibody against cytokeratin (anti-cytokeratin 8 + 18; ab53280, Abcam, Tokyo, Japan). Optimal viability of Annexin V-labeled cells was confirmed by FACS (Cell Sorter SH800S, Sony Biotechnology Inc., Bothell, WA, USA). Vimentin-negative staining indicated the absence of stromal cell contamination. Moreover, FACS analysis confirmed the absence of immune cell contamination using R-Phycoerythrin-conjugated mouse anti-CD45 hematopoietic cell marker (MA1–81458; Thermo Fisher Scientific, Waltham, MA).

Elesh I.F., Marey M.A., Zinnah M.A., Akthar I., Kawai T., Naim F., Goda W., Rawash A.R., Sasaki M., Shimada M, & Miyamoto A. (2021). Peptidoglycan Switches Off the TLR2-Mediated Sperm Recognition and Triggers Sperm Localization in the Bovine Endometrium. Frontiers in Immunology, 11, 619408.

+ Open protocol

+ Expand

Intestinal Crypt Isolation and Cell Sorting

Check if the same lab product or an alternative is used in the 5 most similar protocols

The intestine was cut open longitudinally and incubated with 2 mM EDTA solution at 4 °C for 30 min to isolate intestinal crypts. To generate a single cell suspension, cells were incubated with Accutase (BD Biosciences, Cat#561527) at 37 °C for 10 min. Flow cytometry analysis was performed with CELL SORTER SH800S (SONY, Japan). Cells were gated for single cell based on the profiles of Forward-scatter area versus backward-scatter area (FSC-A vs. BSC-A) and forward-scatter height versus forward-scatter width (FSC-H vs. FSC-W). The size of the nozzle for all sorting is 100 µm.

Chen F., Zhang Y., Hu S., Shi X., Wang Z., Deng Z., Lin L., Zhang J., Pan Y., Bai Y., Liu F., Zhang H, & Shao C. (2020). TIGAR/AP-1 axis accelerates the division of Lgr5− reserve intestinal stem cells to reestablish intestinal architecture after lethal radiation. Cell Death & Disease, 11(7), 501.

+ Open protocol

+ Expand

Yeast Cell Surface Display Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

For library sorting, 5 × 10⁸ induced yeast cells were washed with PBS containing 0.1% BSA (PBS-B) and incubated with 250 nM TAMR-His₆ for 30 min on ice. After washing with PBS-B, cells were stained with Goat F(ab’)₂-anti-human-Kappa PE-conjugate (1:75 dilution, Southern Biotech) to detect surface presentation, with anti-His6 AlexaFluor647-conjugate (1:50 dilution, Thermo Fisher Scientific) for target binding and incubated for 15 min on ice. After a final washing step, cells were analysed by FACS using a Sony Cell Sorter SH800S. Sorting rounds were performed with decreasing target antigen concentrations. For subsequent rounds, TAMR-Fc was used as soluble antigen, staining with an anti-human IgG PE-conjugate (1:50 dilution, Thermo Fisher Scientific).

Fiebig D., Bogen J.P., Carrara S.C., Deweid L., Zielonka S., Grzeschik J., Hock B, & Kolmar H. (2022). Streamlining the Transition From Yeast Surface Display of Antibody Fragment Immune Libraries to the Production as IgG Format in Mammalian Cells. Frontiers in Bioengineering and Biotechnology, 10, 794389.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!