On targetplus sirna

Manufactured by Horizon Discovery

Sourced in United States, United Kingdom, Germany

ON-TARGETplus siRNAs are a set of small interfering RNAs (siRNAs) designed for targeted gene knockdown. They are optimized for potency and specificity to ensure efficient silencing of the target gene.

Automatically generated - may contain errors

Lab products found in correlation

227 protocols using on targetplus sirna

Targeted RNAi Silencing of Chromatin Regulators

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAi was performed by the transfection of siRNA oligos using the Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions. The sequence of siRNA oligos was as followed.
BRD2 (BRD2, Thermo Fisher Scientific, validated Silencer Select siRNA, ID: s12071). BRD3 (BRD3, Thermo Fisher Scientific, validated Silencer Select siRNA, ID: s15544^{48 (link)}). BRD4_1 (BRD4, Thermo Fisher Scientific, validated Silencer Select siRNA, ID: S23901^{48 (link)}). BRD4_2 (BRD4, Dharmacon, siGENOME siRNA, ID: M-004937-02-0005). BRD4_short (BRD4, Qiagen, ID: SI05044865^{22 (link)}). BRD4_long (BRD4, Qiagen, ID: SI05044872^{22 (link)}). XRCC4_1 (XRCC4, Sigma Aldrich, Mission siRNA, ID: SASI_Hs01_00114717). XRCC4_2 (XRCC4, Dharmacon, ON-TARGET plus siRNA, ID: L-004494-00-0005^{49 (link)}). 53BP1_1 (53BP1, Sigma Aldrich, Mission siRNA, ID: SASI_Hs02_00340027). 53BP1_2 (53BP1, Dharmacon, ON-TARGET plus siRNA, ID: L-003548-00-0005^{50 (link)}).

Wakita M., Takahashi A., Sano O., Loo T.M., Imai Y., Narukawa M., Iwata H., Matsudaira T., Kawamoto S., Ohtani N., Yoshimori T, & Hara E. (2020). A BET family protein degrader provokes senolysis by targeting NHEJ and autophagy in senescent cells. Nature Communications, 11, 1935.

+ Open protocol

+ Expand

Knockdown of TRIB1 in human MDMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viromer Green (Lipocalyx) was used to transfect TRIB1 siRNA (ON-TARGET plus siRNA, Dharmacon) and Non-Targeting Control siRNA (ON-TARGET plus siRNA, Dharmacon) in order to knockdown TRIB1 level in humans MDMs according to the manufacturer's instructions.

Kim T., Johnston J., Castillo-Lluva S., Cimas F.J., Hamby S., Gonzalez-Moreno S., Villarejo-Campos P., Goodall A.H., Velasco G., Ocana A., Muthana M, & Kiss-Toth E. (2022). TRIB1 regulates tumor growth via controlling tumor-associated macrophage phenotypes and is associated with breast cancer survival and treatment response. Theranostics, 12(8), 3584-3600.

+ Open protocol

+ Expand

siRNA Transfection for SUN1, SUN2, and MAD2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected using Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s instructions (protocol publication no. MAN0007825 Rev.1.0) with the following siRNAs:
SUN2 rat [Unc84bRSS342353(3_RNAI), Invitrogen]:

Forward (Fw): 5′-GAC UCG GAA GAC CUA UUC AAG AAG A-3′

Reverse (Rv): 5′-U CUU CUU GAA UAG GUC UUC CGA GUC-3′

SUN2 human: SASI_Hs01_00176980 (Sigma-Aldrich)
SUN2#2 human: Silencer Select Predesigned s24467 (Ambion, Thermo Fisher Scientific):

Fw: 5′-CCUUAGAGCAUGUGCCCAAtt-3′

Rv: 5′-UUGGGCACAUGCUCUAAGGta-3′

MAD2 human: Silencer Select Predesigned s8392 (Ambion, Thermo Fisher Scientific):

Fw: 5′-CGCCUUCGUUCAUUUACUAtt-3′

Rv: 5′-UAGUAAAUGAACGAAGGCGga-3′

MAD2#2 human: Silencer Select Predesigned s8393 (Ambion, Thermo Fisher Scientific):

Fw: 5′-CCUUUACUCGAGUGCAGAAtt-3′

Rv: 5′-UUCUGCACUCGAGUAAAGGtt-3′

SUN1#1 human: ON-TARGETplus siRNA (Dharmacon)

Fw: 5′-AUGUUGAAUUGGACGGCCA-3′

Rv: 5′-UGGCCGUCCAAUUCAACAU-3′

SUN1#2 human: ON-TARGETplus siRNA (Dharmacon)

Fw: 5′-GUAUAUACCAAGACGCCAU-3′

Rv: 5′-AUGGCGUCUUGGUAUAUAC-3′

Control siRNA: Silencer Negative Control No. 1 siRNA (AM4635 Ambion, Thermo Fisher Scientific).

Belaadi N., Pernet L., Aureille J., Chadeuf G., Rio M., Vaillant N., Vitiello E., Lafanechère L., Loirand G, & Guilluy C. (2022). SUN2 regulates mitotic duration in response to extracellular matrix rigidity. Proceedings of the National Academy of Sciences of the United States of America, 119(45), e2116167119.

+ Open protocol

+ Expand

Transfection protocol for A549 and H838 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The general scheme of the transfection protocol of A549 cells is illustrated in Figure S1A. 2e 5 cells were plated in 6-cm dishes to achieve 40% confluence at the time of transfection. Cells were transfected with ON-TARGETplus SMARTpool siRNAs (Dharmacon) using Lipofectamine RNAiMAX (13778-150, Life Technologies) for 4 hr at 10 nM in OPTI-MEM media (31985-070, Life Technologies). Subsequently, equal volume of cell media was added containing 20% FBS, to achieve 5 nM siRNA and 10% FBS final concentrations, and the transfection was allowed to go on overnight. Next day, media was exchanged over cells for fresh 10% FBS containing media. The following day, the transfection protocol was repeated again. 24 hr after the second transfection, cells were trypsinized, counted, and plated for 96-well-format growth assays.
Matching control siRNA, NT, was purchased from Dharmacon (D-001810-10-05).
The protocol for siRNA transfection of H838 cells was the same as for A549 cells. GOT1 was knocked down using ON-TARGETplus siRNA (J-011673-10, GE Dharmacon). GOT2 was knocked down using ON-TARGETplus siRNA (J-011674-10, Dharmacon).

Allen E.L., Ulanet D.B., Pirman D., Mahoney C.E., Coco J., Si Y., Chen Y., Huang L., Ren J., Choe S., Clasquin M.F., Artin E., Fan Z.P., Cianchetta G., Murtie J., Dorsch M., Jin S, & Smolen G.A. (2016). Differential Aspartate Usage Identifies a Subset of Cancer Cells Particularly Dependent on OGDH. Cell reports, 17(3).

+ Open protocol

+ Expand

siRNA Transfection and Lentivirus Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

For KD experiments using siRNAs, the different cell lines were transfected in 6‐well plates with Lipofectamine RNAiMax combined with 10 nm of the different ON‐TARGETplus siRNAs from Dharmacon as indicated. 12 h after transfection, cells were trypsinized and seeded for the corresponding assays. For siRNA/DNA cotransfection, cell lines were seeded in 6‐well plates and transfected with Lipofectamine 2000 combined with 10 nm of the ON‐TARGETplus siRNAs from Dharmacon and 1 µg of plasmid DNA. For lentivirus generation, 1 × 106 HEK293T cells were seeded in 6‐well plates in DMEM 10% FBS the day before transfection. 1 µg of pLenti6‐H2B‐mCherry, pHR_dSV40‐Aurora A–GFP, pLenti6‐ADRP, or pLKO vectors were transfected in the cells with Lipofectamine 2000 (Invitrogen 11668027), in combination with 1 µg psPAX2 and 100 ng pMD2.G. 48 h later, the supernatant was recovered, filtered, and used to infect the cells.

Rios Garcia M., Meissburger B., Chan J., de Guia R.M., Mattijssen F., Roessler S., Birkenfeld A.L., Raschzok N., Riols F., Tokarz J., Giroud M., Gil Lozano M., Hartleben G., Nawroth P., Haid M., López M., Herzig S, & Berriel Diaz M. (2022). Trip13 Depletion in Liver Cancer Induces a Lipogenic Response Contributing to Plin2‐Dependent Mitotic Cell Death. Advanced Science, 9(29), 2104291.

+ Open protocol

+ Expand

Depletion of GADD34 and CReP Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two specific ON-Target plus siRNA was purchased for each gene from Dharmacon Inc. targeting PPP1R15A (cat# J004442–05 and J00442–08) and PPP1R15B (cat# J015013–05 and J015013–08). These siRNAs were used to deplete protein levels of GADD34 and CReP protein levels respectively. A non-targeting siRNA from Dharmacon Inc. (cat # D-001810–10) was used as a control. Transfection of siRNA was performed using Dharmafect I reagent (Dharmacon Inc., Lafayette, CO) and the cells were harvested after 48 hours of transfection for protein extraction.

Sengupta S., Sevigny C.M., Bhattacharya P., Jordan V.C, & Clarke R. (2019). Estrogen induced apoptosis in breast cancers is phenocopied by blocking dephosphorylation of eukaryotic initiation factor 2 alpha (eIF2α) protein.. Molecular cancer research : MCR, 17(4), 918-928.

+ Open protocol

+ Expand

Knockdown of AKTIP, SGK3 and STAT3

Check if the same lab product or an alternative is used in the 5 most similar protocols

ON-TARGETplus siRNA targeting human AKTIP, SGK3 and STAT3 as well as SMARTpool ON-TARGETplus siRNA targeting 10 AKTIP-bound proteins were purchased from Dharmacon (Lafayette, CO). ESR1, CAND1, FASN and USP7 siRNA were obtained from Integrated DNA Technologies (Coraville, IA). The siRNA sequences are listed in Table S3. Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) was used to transfect siRNA at 10 nM. shRNA against AKTIP in pLKO.1-Puro lentiviral vector was developed by The RNAi Consortium (TRC).^{87 (link)} pcDNA3-myc3-CUL2 and pcDNA3-myc3-NEDD8 were gifts from Yue Xiong (Addgene plasmid # 19892 and # 19943).^{84 (link),85 (link)} Transfection of plasmids was performed using Lipofectamine 3000 (Invitrogen). MCF7 cells stably expressing AKTIP shRNA or vector control were established by lentiviral transduction followed by puromycin selection.

Ng A.S., Zhang S., Mak V.C., Zhou Y., Yuen Y., Sharma R., Lu Y., Zhuang G., Zhao W., Pang H.H, & Cheung L.W. (2022). AKTIP loss is enriched in ERα-positive breast cancer for tumorigenesis and confers endocrine resistance. Cell reports, 41(11), 111821.

+ Open protocol

+ Expand

Knockdown of TDP-43 in SH-SY5Y Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

SH-SY5Y human neuroblastoma cells (ATCC Cat# CRL-2266) were cultured in DMEM F12 (Gibco, Cat#1132-033) containing 1% of Penicillin–Streptomycin (Gibco, Cat#15140-122) and 10% of Fetal Bovine Serum (Sigma, Cat# F0926) and kept at 37 °C and 5% CO₂. TDP-43 knockdown was achieved by transfecting cells with pooled siRNAs against TARDBP (ON-TARGETplus siRNA, Dharmacon, Cat# L-012394) or control siRNA (ON-TARGETplus Non-targeting Control Pool, Dharmacon, Cat# D001810–10) using Lipofectamine RNAiMAX Transfection Reagent (Cat# 13778075) in Opti-MEM™ (Gibco, Cat#31985070). For the dose-dependency analyses we used decreasing amounts of siRNAs ranging from 25 to 0.125 pmol per well. Cells were treated with siRNA either for 3 or 5 days, as previous studies reported decrease in UNC13A transcripts after longer knockdown of TDP-43 [16 (link), 57 (link)].

Agra Almeida Quadros A.R., Li Z., Wang X., Ndayambaje I.S., Aryal S., Ramesh N., Nolan M., Jayakumar R., Han Y., Stillman H., Aguilar C., Wheeler H.J., Connors T., Lopez-Erauskin J., Baughn M.W., Melamed Z., Beccari M.S., Olmedo Martínez L., Canori M., Lee C.Z., Moran L., Draper I., Kopin A.S., Oakley D.H., Dickson D.W., Cleveland D.W., Hyman B.T., Das S., Ertekin-Taner N, & Lagier-Tourenne C. (2024). Cryptic splicing of stathmin-2 and UNC13A mRNAs is a pathological hallmark of TDP-43-associated Alzheimer’s disease. Acta Neuropathologica, 147(1), 9.

+ Open protocol

+ Expand

Melanoma Cell Lines and LPA Signaling Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

WM239A, WM1158 and WM852 melanoma cell lines were obtained from the Wellcome Trust Functional Genomics Cell Bank (Biomedical Sciences Research Centre, St George's, University of London, UK). Cells were cultured in RPMI medium (Invitrogen) supplemented with 2 mM l-glutamine (Gibco) and 10% fetal bovine serum (FBS; PAA Laboratories) and confirmed mycoplasma free.
1-Oleoyl-2-hydroxy-sn-glycero-3-phosphate (18:1) and 1-arachidonoyl-2-hydroxy-sn-glycero-3-phosphate (20:4) LPA was obtained from Avanti. FlexiTube GeneSolution sets of four siRNAs (Qiagen) were used to target LPP1, LPP2 and LPP3. LPP3 siRNA 1 was oligo 6 from the ON-TARGET plus siRNA range (J-017312-06-0005; GE Dharmacon; siRNA sequence: GGGACUGUCUCGCGUAUCA), LPP3 siRNA 2 was oligo 7 from the FlexiTube siRNA range (SI03043761, Qiagen; siRNA sequence: AGCGATCGTCCCGGAGAGCAA), scrambled non-targeting siRNA control was AllStars negative control siRNA (Qiagen). Ki16425 (Cambridge Bioscience) was used at a final concentration of 10 μM. HA130 (Echelon Biosciences) was used at a final concentration of 500 nM.

Susanto O., Koh Y.W., Morrice N., Tumanov S., Thomason P.A., Nielson M., Tweedy L., Muinonen-Martin A.J., Kamphorst J.J., Mackay G.M, & Insall R.H. (2017). LPP3 mediates self-generation of chemotactic LPA gradients by melanoma cells. Journal of Cell Science, 130(20), 3455-3466.

+ Open protocol

+ Expand

Silencing Rat OGT Using siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The first two individual pre-designed specific siRNA specifically targeting rat OGT mRNA, rat OGT and non-targeting control were used (ON-TARGETplus siRNA, Dharmacon, GE Healthcare). NCMs were plated (100,000 cells/well) in 6-well plates and were allowed to grow for 24 h without antibiotics. The first 2 individual OGT (OGT1 and OGT2) siRNAs (5 nmol/L) were transfected with the DharmaFECT® reagent (4 μL) according to the manufacturer's recommendations. Total cell extracts were collected 72 h after transfection.

Mercier T., Bouvet M., Dubois-Deruy E., Dechaumes A., Beseme O., Richard V., Mulder P, & Pinet F. (2018). Interplay Between Phosphorylation and O-GlcNAcylation of Sarcomeric Proteins in Ischemic Heart Failure. Frontiers in Endocrinology, 9, 598.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!