Total mRNA was extracted from the tibialis muscle and cells using a HybridR RNA isolation kit (GeneAll, Seoul, Republic of Korea). The Reverse Transcription Premix was used to synthesize cDNA (ELPIS-Biotech, Daejeon, Republic of Korea). qRT-PCR was performed on a Light Cycler 480 Real-Time PCR System (Roche, Basel, Switzerland) using PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific) with gene-specific primers (summarized in Table 1 ). To account for potential variations, target mRNA expression was normalized against the housekeeping gene mouse β-actin. Relative gene expression was then calculated using the 2−ΔΔCt method as previously described [22 (link)].
Hybrid r rna isolation kit
Manufactured by GeneAll
The Hybrid-R RNA isolation kit is a laboratory equipment designed for the extraction and purification of RNA from various biological samples. It utilizes a proprietary hybrid method to efficiently isolate high-quality RNA, suitable for downstream applications such as qRT-PCR, RT-PCR, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (3 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Reverse transcription premix, by Elpis Biotech (1 mentions)
Lightcycler 480 real time pcr system, by Roche (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Primescript cdna synthesis kit, by Takara Bio (1 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Lightcycler 480 pcr system, by Roche (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
6 protocols using hybrid r rna isolation kit
1
Quantitative Real-Time PCR Analysis of mRNA
2
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate RNA from RAW 264.7 cells, cultured cells were washed using cold phosphate-buffered saline (PBS) and harvested with a Hybrid-R RNA Isolation Kit (GeneAll, Seoul, Korea). Frozen colon, PPs, and splenic tissues were extracted using same kit. cDNA was synthesized using a PrimeScript cDNA Synthesis Kit (Takara, Shiga, Japan) following the manufacturer’s protocol. qRT-PCR was performed using Power SYBR Green Master Mix (Thermo Fisher Scientific) and detected using a Light Cycler 480 (Roche, Basel, Switzerland). The sequences of primers are presented in Additional File 1 .
3
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mycelia from the in vitro experiments were harvested at the appropriate time, weighed, frozen in liquid nitrogen, lyophilized for 24 h and kept at −80°C until use. In colonized nectarines, mycelia containing exocarp (peel) was removed, frozen in liquid nitrogen and lyophilized prior to RNA extraction. Total RNA was extracted from 100 mg of lyophilized tissue of the selected samples using the Hybrid-R RNA isolation kit (GeneAll, Seoul, South Korea) according to the manufacturer’s protocol. The DNase and reverse-transcription reactions were performed on 1 μg of total RNA with the Maxima First-Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, United States) according to the manufacturer’s instructions. The cDNA samples were diluted 1:10 (v/v) with ultrapure water. The quantitative real-time PCR was performed using Fast SYBR green Master Mix (Applied Biosystems, Waltham, MA, United States) in a StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, United States). The PCR conditions were as follows: 95°C for 20 s, followed by 40 cycles of 95°C for 3 s and 60°C for 20 s. The samples were normalized using β-tubulin as endogenous control and the relative expression levels were measured using the 2(–ΔΔCt) analysis method. Results were analyzed with StepOne software v2.3. Primer sequences used for qRT-PCR analysis are listed in Supplementary Table S2 .
4
Quantitative Real-Time PCR Analysis of Fungal Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mycelia from the in vitro experiments were harvested at the appropriate time, weighed, frozen in liquid nitrogen, lyophilized for 24 h and kept at −80 °C until used. Total RNA was extracted from 100 mg of ground mycelium of the selected samples using the Hybrid-R RNA isolation kit (GeneAll, Seoul, Korea) according to the manufacturer’s protocol. The DNase and reverse-transcription reactions were performed on 1 µg of total RNA with the Maxima First-Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The cDNA samples were diluted 1:10 (v/v) with ultrapure water. The quantitative real-time PCR was performed using Fast SYBR green Master Mix (Applied Biosystems, Waltham, MA, USA) in a StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The PCR conditions were as follows: 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s and 60 °C for 20 s. The samples were normalized using β-tubulin as endogenous control and the relative expression levels were measured using the 2(−ΔΔCt) analysis method. Results were analyzed with StepOne software v2.3. Primer sequences used for qRT-PCR analysis are listed in Table S1 .
5
Quantitative Gene Expression Analysis
6
Investigating Gene Expression Profiles after PMA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the gene expression profile after PMA treatment, qRT-PCR was performed. Briefly, total RNA was extracted from each sample using a Hybrid-R™ RNA Isolation Kit (GeneAll, Seoul, Korea) according to the manufacturer's instructions. The expression levels of TNFα, BACH1, CEBPβ and IRF4 genes were determined using two-step qRT-PCR. Reverse transcription was performed using a High Capacity RNA-to-cD-NA kit (Applied Biosystems). SYBR Premix EX Taq TM (Takara Bio, Shiga, Japan) with the specific primers, TNFα: forward primer, 5'-CGAGTGACAAGCCT-GTAGC-3' reverse primer, 5'-GGTGTGGGT-GAGGAGCACAT-3', BACH-1: forward primer, 5'-TTCATGCTTCTGTTCAGCCAA-3', reverse primer, 5'-GGCACTGAGAAGCAGG ATCTTT-3', CEBPβ: forward primer, 5'-GACAAGCACAGCGACGAGTA-3', reverse primer, 5'-AGCTGCTCCACCTTCTTCTG-3', IRF4: forward primer, 5'-TCCGCCAGTGGCTGATC-GAC-3', reverse primer, GAPDH: forward primer, 5'-GAAGGTGAAGGTCGGAGTC-3', 5'-reverse primer, GAAGATGGTGATGGGATTTC -3' was used during the real-time PCR step followed by 40 cycles of denaturation at 95°C for 3 sec, annealing at 60°C for 30 sec, and finally the melt curve stage at 95°C for 30 sec, 60°C for 1 min, and 95°C for 30 sec. The amplification of target genes with GAPDH as an internal control was performed using a LightCycler® 480 PCR System (Roche Molecular System).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!