ClpP constructs were expressed in the BL21(DE3)1146D strain, which lacks the gene for endogenous EcClpP. EcClpP and NmClpP were expressed and purified generally as previously described for EcClpP45 (link). Briefly, an overnight culture of BL21(DE3)1146D cells transformed with the respective ClpP plasmid was inoculated at a 1:100 dilution into LB media supplemented with ampicillin. The culture was agitated for 3 h at 37 °C to an OD600 of 0.5 to 0.7. IPTG was added to a final concentration of 1 mM, and the culture was incubated for another 4 h. Cells were harvested by centrifugation and resuspended in buffer A (50 mM TrisHCl, pH 7.5, 150 mM KCl, 10% glycerol, and 1 mM DTT), and lysed using a French Press. The protein was then fractionated using ammonium sulfate precipitation, resuspended in buffer A and, subsequently, purified on a Q-Sepharose column followed by an SP Sepharose column or a Superdex 200 column (all columns from GE Healthcare Life Sciences). N-terminal sequencing of NmClpP was carried out by sequential Edman reactions at the SPARC BioCentre at The Hospital for Sick Children, Toronto. Protein concentrations were determined by absorbance at 280 nm with extinction coefficients calculated using ProtParam (http://ca.expasy.org/tools/protparam.html ) or by Bradford assay (Bio-Rad Laboratories).
Sp sepharose column
Manufactured by GE Healthcare
Sourced in United States, Sweden
The SP-Sepharose column is a chromatography media used for the purification of proteins and biomolecules. It contains sulfopropyl (SP) functional groups attached to a sepharose matrix, which allows for cation exchange chromatography. The SP-Sepharose column facilitates the separation and purification of positively charged molecules from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Hitrap hp column, by GE Healthcare (2 mentions)
Hitrap, by Cytiva (2 mentions)
Superdex 200 column, by GE Healthcare (1 mentions)
Bradford assay, by Bio-Rad (1 mentions)
Pfu dna polymerase, by Thermo Fisher Scientific (1 mentions)
Protein g column, by GE Healthcare (1 mentions)
S75 size exclusion column, by GE Healthcare (1 mentions)
Q sepharose column, by GE Healthcare (1 mentions)
Chelerythrine, by Merck Group (1 mentions)
Hiprep 26 10 column, by GE Healthcare (1 mentions)
Hiprep, by Cytiva (1 mentions)
Amicon ultra 30k 10k, by Merck Group (1 mentions)
Ta cloning kit, by Takara Bio (1 mentions)
Quickchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Superdex 75 column, by GE Healthcare (1 mentions)
Constant cell disruption system, by Constant Systems (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
Pierce high capacity endotoxin removal resin, by Thermo Fisher Scientific (1 mentions)
Hek293f, by Thermo Fisher Scientific (1 mentions)
Superdex 75 16 60, by GE Healthcare (1 mentions)
20 protocols using sp sepharose column
1
Purification of EcClpP and NmClpP Proteases
2
Purification of Mutant PPARγ Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PPARγ containing domains from DBD to the C-terminus (CDE domains, residues 103–477) was expressed as an N-terminal 6×His fusion protein (H6-PPARγ CDE) from the expression vector pET24a (Novagen, Germany). 3RA mutant plasmid was constructed by site-directed mutagenesis with forward primer: AGGATGCAAGGGTTTCTTCGCGGCAACAA
TCGCATTGAAGCTTATCTATGACAG, and reverse primer: CTGTCATAGATAAGCTTCA
ATGCGATTGTTGCCGCGAAGAAACCCTTGCATCCT, using Pfu DNA polymerase (Thermo Fisher Scientific, USA). BL21(DE3) cells transformed with the expression plasmids were grown in LB broth at 25°C to an OD600 of approximately 1.0 and induced with 0.1 mmol/L isopropyl 1-thio-β-d -galactopyranoside (IPTG) at 16°C. Cells were harvested and sonicated in 100 ml of extract buffer (20 mmol/L Tris pH8.0, 150 mmol/L NaCl, 10% glycerol, and 25 mmol/L imidazole) per 2 liters of cells. After sonication, the lysate was centrifuged at 20,000 rpm for 30 min, and the supernatant was loaded on a 5-ml NiSO4-loaded HiTrap HP column (GE Healthcare, PA, USA). The column was washed with extract buffer, and the protein was eluted with a gradient of 25 to 500 mmol/L imidazole. The PPARγ CDE was further purified with a SP-Sepharose column (GE Healthcare, PA, USA).
TCGCATTGAAGCTTATCTATGACAG, and reverse primer: CTGTCATAGATAAGCTTCA
ATGCGATTGTTGCCGCGAAGAAACCCTTGCATCCT, using Pfu DNA polymerase (Thermo Fisher Scientific, USA). BL21(DE3) cells transformed with the expression plasmids were grown in LB broth at 25°C to an OD600 of approximately 1.0 and induced with 0.1 mmol/L isopropyl 1-thio-β-
3
Recombinant NaD1 Defensin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mature defensin domain of NaD1 was expressed as secreted recombinant protein in the methylotropic yeast Pichia pastoris and purified using an SP Sepharose column (GE Healthcare, Buckinghamshire, UK) as described previously.47
4
Fab Protein Purification from E.coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fabs were cloned and expressed in E. coli47 (link),48 (link). Briefly, E.coli cell paste containing the expressed Fab was harvested from fermentations and dissolved into phosphate-buffered saline (PBS) buffer containing 25 mM EDTA and 1 mM phenylmethylsulfonyl fluoride. The mixture was homogenized and then passed twice through a microfluidizer. The suspension was then centrifuged at 21,500 × g for 60 min. The supernatant was then loaded onto a Protein G column (GE Healthcare, Piscataway, NJ) equilibrated with PBS at 5 mL/min. The column was washed with PBS buffer and proteins were then eluted with 0.6% acetic acid. Fractions containing Fabs were pooled and then loaded onto a 50-mL SP Sepharose column (GE Healthcare, Piscataway, NJ) equilibrated in 20 mM MES pH 5.5. The column was washed with 20 mM MES buffer pH 5.5 for 2 column volumes and then eluted with a linear gradient to 0.5 M NaCl in 20 mM MES buffer pH 5.5. For final purification, Fab-containing fractions from the ion exchange chromatography were concentrated and run on a S75 size-exclusion column (GE Healthcare, Piscataway, NJ) in PBS buffer.
5
Purification of Engineered BsdYP Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pVB4, containing the wild-type bsdyp gene without a signal peptide, and plasmids harboring the hit variant genes were introduced into E. coli Tuner (DE3, Novagen, Merck, Darmstadt, Germany), which were cultivated in 2.5 L of LB medium. Crude extracts were loaded onto a SP-Sepharose column (GE, Healthcare, Bio-Sciences, Chicago, IL, USA), previously equilibrated with 20 mM Tris-HCl buffer, pH 7.6. Elution was performed by applying a 0–50% gradient with 1 M NaCl in 5 column volumes, followed by a second gradient of 50–100% in 2 column volumes. The active fractions were collected, pooled and concentrated, before applying onto a Superdex 75 HR 16/60 (GE Healthcare, Bio-Sciences, Chicago, IL, USA), pre-equilibrated with 20 mM Tris-HCl buffer with 0.2 M NaCl, pH 7.6 [22 (link)]. The protein concentration was determined using the extinction coefficient ε280 = 36,900 M−1cm−1. The heme content was determined by the pyridine ferrohemochrome method using an extinction coefficient of ƐR-O 556 (28.32 mM−1cm−1) [58 (link)]. UV–visible absorption spectra of purified enzymes were performed in a Nicolet Evolution 300 spectrophotometer (Thermo Industries, Waltham, MA, USA).
6
Purification of Core Histones from E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Core histones were expressed in E. coli BL21 (DE3) RIL cells using ZYM-5052 auto-inducing medium. Histone proteins were found exclusively in inclusion bodies, which were solubilized in unfolding buffer (7 M deionized urea, 20 mM Tris-HCl (pH 7.5), 10 mM DTT). The material was dialyzed against urea chromatography buffer (7 M deionized urea, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 100 mM NaCl, 2 mM DTT, 0.2 mM PMSF) and loaded onto a Q Sepharose column in front of a SP Sepharose column (both GE Healthcare, Freiburg Germany). After washing with five column volumes of urea chromatography buffer, the Q Sepahraose column with bound DNA and contaminating proteins was removed. Histone proteins were eluted from the SP Sepharose column using a linear gradient from 0.1 to 0.6 M NaCl. Purified histones were dialyzed extensively against ddH2O, lyophilized and stored at −80°C.
7
Quantification of Recombinant BvLzm in Transgenic Plant Extracts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the levels of recombinant BvLzm, enzyme activity and enzyme-linked immunosorbent assays (ELISA) were performed on TSP from culm extract juice. Juice was extracted from 1.0 kg of culms of greenhouse grown BvLzm transgenic plants at 7, 9 and 11 months for the growth cycle experiment and at 2, 6 and 8 months for the fertilization experiment. For enzyme activity determination, culm extract juice was tested for its ability to lyse Micrococcus lysodeikticus cells using the standard protocol from Sigma-Aldrich (St. Louis, MO). Rabbit anti-BvLz antibody used in the ELISA was synthesized by Bethyl Laboratories, Inc. (Montgomery, TX) using tobacco-derived BvLz31 and further purified through an SP-Sepharose column (GE Healthcare, Piscataway, NJ). ELISA of culm extract juice was performed as previously described30 (link). Briefly, a sandwich ELISA consisting of anti-BvLz antibody was used to capture BvLz in juice. Detection was performed using a biotinylated anti-BvLz antibody and horseradish peroxidase-labeled NeutrAvidin (Pierce, ThermoFisher Scientific). The standard curve was generated using BvLz produced in Pichia pastoris as in Digan et al.80 .
8
Purification of D-HEWL Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of D-HEWLPP was achieved as described by Campbell et al. (2018 ▸ ). Since the protein was secreted into the extracellular medium, the supernatant was recovered upon cell pelleting. The supernatant was diluted by the addition of 50 mM Tris–HCl pH 7.8 buffer to achieve a solution conductivity of below 10 mS cm−1. Pure protein was obtained by ion-exchange chromatography (IEC) using an SP-Sepharose column (GE Healthcare) and elution with a 30 ml NaCl gradient from 0 to 1 M in 50 mM Tris–HCl pH 7.8 buffer. Following the same approach as the final buffer exchange of D-HEWLEC, the D-HEWLPP buffer was exchanged to 50 mM sodium acetate pD 4.5 in D2O by desalting. The protein was concentrated to 30 mg ml−1 for crystallization experiments.
9
Purification and Reconstitution of PPARγ LBD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PPARγ LBD (residues 206–477) was expressed as an N-terminal 6xHis fusion protein from the expression vector pET24a (Novagen, Germany). BL21(DE3) cells transformed with the expression plasmid were grown in LB broth at 25 °C to an OD600 of approximately 1.0 and induced with 0.1 mmol/l isopropyl 1-thio-β-D-galactopyranoside (IPTG) at 16 °C. Cells were harvested and sonicated in 200 ml of extract buffer (20 mmol/l Tris pH 8.0, 150 mmol/l NaCl, 10% glycerol, and 25 mmol/l imidazole) per 6 liters of cells. The lysate was centrifuged at 20,000 rpm for 30 min, and the supernatant was loaded on a 5-ml NiSO4-loaded HiTrap HP column (GE Healthcare, PA, USA). The column was washed with extract buffer, and the protein was eluted with a gradient of 25–500 mmol/l imidazole. The PPARγ LBD was further purified with a SP-Sepharose column (GE Healthcare, PA, USA). To prepare the protein-ligand complex, 5-fold excess of the chelerythrine (Sigma, USA) and 2-fold excess of steroid receptor coactivator 1 (SRC1) peptide (AQQKSLLQQLLTE) were added to the purified protein, followed by filter concentration to 10 mg/ml.
10
Purification of Cellulase Enzymes EG VI, CBH IIa, and CBH IIb
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 20 ml sample of the whole cocktail obtained with the procedure described above was loaded onto an SP-Sepharose column (GE Healthcare) equilibrated with the same buffer (50 mM sodium acetate, pH 5.0). EG VI was eluted with 1 M sodium chloride, 50 mM sodium acetate buffer (pH 5.0). Collected fractions were desalted using HiPrep 26/10 column (GE Healthcare) and were analyzed by mass spectrometry and SDS-PAGE to identify and check their purity. CBH IIa and CBH IIb were purified following the procedures described by Bukhtojarov et al. [35 (link)] and Gusakov et al. [27 (link)] respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!