Polymerase chain reaction (PCR) was used to identify the Cep250 KO allele using primers listed in Table 1 and the KAPA Mouse Genotyping Kit (KR0385; Kapa Biosystems) or the 2x PCRBIO HS Taq Mix Red Kit (PB10.23.02; PCR Biosystems, London, UK).Thermal cycling conditions were primary denaturation at 94°C for 10 minutes; 40 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and DNA extension at 72°C for 30 seconds; and a final extension cycle at 72°C for 5 minutes.
Pcrbio hs taq mix red kit
Manufactured by PCR Biosystems
The 2x PCRBIO HS Taq Mix Red Kit is a ready-to-use solution for high-sensitivity PCR amplification. It contains all the necessary components, including a high-performance Taq DNA polymerase, dNTPs, and reaction buffer, pre-mixed and optimized for efficient and reliable PCR results.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pcrbio hs taq mix red kit
1
Cep250 Knockout Allele Identification
2
Mitochondrial Mutation Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mt3243T>C and the mt14319T>C mutations were sequenced using the following primer sets. For mt3243T>C; mt2941F‐GCGCAATCCTATTCTAGAGT and mt4632R‐CTTCTGTGGAACGAGGGTTT; for mt14319T>C; mt13837F‐GCCCTAGACCTCAACTACCT and mt14570R‐GCGGTGTGGTCGGGTGTGTT were used. The PCR reaction was performed using the 2X PCRBIO HS Taq Mix Red Kit (PCR Biosystems). Sequencing was conducted by Macrogen, and the data were analyzed using SnapGene v.5.2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!