The largest database of trusted experimental protocols

Sc 12984

Manufactured by Santa Cruz Biotechnology
Sourced in United States

Sc-12984 is a laboratory equipment product manufactured by Santa Cruz Biotechnology. It is designed for use in scientific research and clinical applications. The core function of Sc-12984 is to provide a reliable and precise measurement or analysis of specific biological or chemical samples. Further details about the intended use or specific features of this product are not available.

Automatically generated - may contain errors

6 protocols using sc 12984

1

Allele-Specific ChIP-qPCR Enrichment Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed as described in the ChIP-Seq section above with antibody dilutions as described. Additional antibodies used included anti-MYB (Abcam ab45150) and anti-TAL1 (Santa Cruz sc12984). Allele-specific enrichment was detected using allele-specific primers in quantitative real-time PCR performed on a 7000 AB Detection System according to the manufacturer's instructions (Applied Biosystems). The following primers were used:
Insertion containing allele: (5′–3′) TCCTGCCCTGCGGTTTAACG, and (5′–3′) GATCTGCTTCTTGGAGAGCTGC
Reference allele: (5′–3′) GCCCTGCGTGAGTTTACTGTG and (5′–3′) GATCTGCTTCTTGGAGAGCTGC
Enrichment was calculated using the delta Ct method against a negative control region amplified by the following primers: (5′–3′) CCCACCTTGTGTTCAAATGCTGA and (5′–3′) ACGCTTTTCTTCTGCCTTCTGC. The values calculated in the ChIP samples were subsequently normalized against those measured using the ChIP input DNA as a template in the qPCR reaction.
+ Open protocol
+ Expand
2

Protein Expression Analysis in MEL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole-cell extract of MEL or mouse fetal liver cells were analyzed by polyacrylamide gel electrophories (PAGE) and Western blotting, following the standard protocols. Enhanced chemiluminescence (ECL) detection system (Omics Biotechnology Co., Taipei, Taiwan) was used to visualize the hybridizing bands on the blots. Goat anti-TAL1 antibodies, sc-12982 and sc-12984, were purchased from Santa Cruz, Inc., Anti-Flag (M2), anti-Tubulin(B-5-1-2), and anti-β-Actin (AC-15) mouse antibodies were purchased from Sigma-Aldrich (St. Louis, MO, USA). The anti-EKLF antibody (anti-AEK) was homemade [19 (link)].
+ Open protocol
+ Expand
3

Transcription Factor Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Knockdown of TAL1, RUNX1 and GATA1 was achieved with shRNAs present in the pGIPZ vector (Open Biosystems) [17 (link)]. The accession numbers of the pGIPZ constructs is given in Supplementary Material. Controls were expressing non-targeting shRNA from the corresponding backbone. Knockdown was verified by qRT-PCR (Figure 5). A corresponding western blot from the same lysates showing the decreased protein amount of TAL1, RUNX1 and GATA1 is shown in [17 (link)]. For western blot analysis whole cell extracts from transfected HEK293 cells were used. Proteins were separated using SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with Roti-Block (Carl Roth) and exposed to primary antibody dilution over night at 4°C. Afterwards membranes were incubated with appropriate secondary antibodies coupled to horseradish peroxidase (HRP) for 1h at room temperature. Signals were visualized using Western Super ECL reagent (Pierce) and analysed using X-ray film. Immunoblotting analysis was performed using anti-TAL1 (sc-12984, Santa Cruz), anti-RUNX1 (ab23980, Abcam), anti-GATA1 (sc-1233, Santa Cruz) and anti-Tubulin (ab7291, Abcam).
+ Open protocol
+ Expand
4

ChIP-exo: Chromatin Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
With the following modifications, ChIP-exo was performed as previously described [24 (link)] with chromatin extracted from 50 million cells, ProteinG MagSepharose resin (GE Healthcare), and 5 μg of antibody directed against the H3K4me1, H3K4me3, H3K27ac, or Tal1 (Abcam ab8895, ab8580, ab4729, and Santa Cruz Biotech sc-12984, respectively). First, formaldehyde cross-linked cells were lysed with buffer 1 (50 mmol/L HEPES–KOH, pH 7.5; 140 mmol/L NaCl; 1 mmol/L EDTA; 10% glycerol; 0.5% Nonidet P-40; 0.25% Triton X-100) and washed once with buffer 2 (10 mmol/L Tris–HCL, pH 8; 200 mmol/L NaCl; 1 mmol/L EDTA; 0.5 mmol/L EGTA), and the nuclei were lysed with buffer 3 (10 mmol/L Tris–HCl, pH 8; 100 mmol/L NaCl; 1 mmol/L EDTA; 0.5 mmol/L EGTA; 0.1% sodium deoxycholate; 0.5% N-lauroylsarcosine). All cell lysis buffers were supplemented with fresh EDTA-free complete protease inhibitor cocktail (CPI, Roche, No. 11836153001). Purified chromatin was sonicated with a Bioruptor (Diagenode) to obtain fragments ranging from 100 bp to 500 bp. Triton X-100 was added to extract at 1% to neutralize sarcosine. Insoluble chromatin debris was removed by centrifugation, and sonication extracts were stored at −80°C until used for ChIP analysis.
+ Open protocol
+ Expand
5

Western Blot Analysis of Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole-cell lysates were prepared with RIPA buffer supplemented with protease inhibitors (Roche), NaF (10mM), PMSF (1mM) and Na3VO4 (1mM) or cells were directly lysed in SDS sample buffer. Proteins were separated using SDS-PAGE and transferred to PVDF membranes. Antibodies used for immunoblot from Cell Signaling Technology were pS473 AKT (4051), AKT (4691), pT202/Y204 ERK (9101), ERK (9102), Trib2 (13533), and C/EBPα (8178). The antibody against TAL1 was purchased from Santa Cruz Biotechnology (sc-12984). β-actin (A5316; Sigma) was used as a loading control. Secondary anti-mouse-HRP (NA931V) and anti-rabbit-HRP (NA934V) were obtained from GE Healthcare. Blots were visualized with SuperSignal west pico chemilumenscence (34080; Thermo Scientific) or SuperSignal west femto chemilumenscence substrate (34095; Thermo Scientific).
+ Open protocol
+ Expand
6

Western Blot and FACS Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoblot analysis was performed using anti-Tal1 (sc-12984, Santa-Cruz, 1:1,000 dilution and
04–123, Millipore, 1:500 dilution), anti-PADI4 (ab96758, 1:500 dilution and
ab128086, 1:2,000 dilution, Abcam), anti-HA (sc-805, Santa-Cruz, 1:1,000
dilution), anti-Flag (F3165, 1:4,000 dilution, Sigma-Aldrich),
anti-LaminB1 (ab16048,
Abcam, 1:1,000 dilution) and anti-CTCF (ab70303, Abcam, 1:1,000 dilution). Western blots were
analysed using X-ray film or an imaging system (Fusion FX7, PEQLAB, Erlangen,
Germany). Uncropped images are provided in Supplementary Figs 12–15. FACS
analysis of gp130 surface
staining was performed using an APC-labelled gp130 antibody (R&D Systems, FAB228A).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!