Invisorb spin tissue mini kit

Genotyping was accomplished by isolating genomic DNA from tail tips, using the INVISORB spin tissue mini kit (Stratec, Berlin, Germany) and quantified afterward by PCR. The following primers were used: Klk7 loxP sites, 5′-GGGATGTAGGATTATGAGTGAGC-3′ (forward) and 5′-CAGTCCAGTGAACTGCTCACC-3′ (reverse), as well as Cre-recombinase, 5′-GCGGTCTGGCAGTAAAAACTATC-3′ (forward) and 5′-GTGAAACAGCATTGCTGTCACTT-3′ (reverse). PCR was performed for 35 cycles, 95 °C for denaturation (loxP sites and Cre), 60 °C (loxP sites) or 56 °C (cre) for annealing and 72 °C (loxP sites and Cre) for elongation performed with the Fermentas Dream Taq Polymerase (Fermentas, St. Leon-Rot, Germany) and a Peltier Thermal Cycler PTC-200 (Bio-Rad, Hercules, CA, USA). With DNA from control mice, a 276 bp band and with DNA from ATKlk7^−/− mice a 402 bp band were obtained on agarose gel.

DNA was extracted from muscle tissue of the B. variegata grandfather using the Invisorb Spin Tissue Minikit (Stratec, Germany). PCR-free TruSeq libraries with mean insert sizes of 350 bp (n = 8) and 550 bp (n = 2) were prepared by Edinburgh Genomics and sequenced on the Illumina HiSeq X, producing 6.67 × 10⁹ (350 bp insert) and 1.05 × 10⁹ (550 bp insert) read pairs (150 bp, PE). Adapter removal and quality trimming were carried out with bbduk (BBMap suite v.36.76, B. Bushnell, sourceforge.net/projects/bbmap/). Parameters for adapter removal were k = 23, mink = 8, and edist = 1 for R1 and k = 23, mink = 8, and edist = 2 for R2. Quality trimming parameters were trimq = 20, maq = 25, and minlength = 50. Genome size was estimated from unassembled reads with the preqc module of the String Graph Assembler (SGA, v. 0.10.15) (Simpson and Durbin 2012 (link); Simpson 2014 (link)) using a subset of 1.1 × 10⁹ read pairs. All libraries were evenly represented in this and subsequent analyses.

DNA from rat tissues was isolated using Invisorb Spin Tissue Mini Kit (Stratec Biomedical Systems, Birkenfeld, Germany). PCR was run with AmpliTaq Gold 360 polymerase (Thermo Fisher Scientific, Waltham, MA 02451, USA), 0.2 mM dNTPs (Merck KGaA, Darmstadt, Germany), and 0.5 μM of the following primers (Generi Biotech s.r.o., Hradec Králové, Czech Republic): TMEM70 ZFN-F CAGCATGTTGTTGCCTATGG, TMEM70 ZFN-R AGACCACACAATCTGGGACC. PCR products were resolved by 1.5% agarose gel electrophoresis. The presence of the Tmem70 transgene was evaluated by qPCR using primers, allowing amplification specifically from vector Tmem70 cDNA containing no introns. Primers were placed in exon 1 (F- GGCAGGCTGATTTATACTGGGA) and exon 2 (R- AAGGCTGACCACACTTGTAGA). The albumin gene was used as a control (F- AAGACGGCCATGTTTCTCTG, R- TGGAAGGTGAAGGTCTCAGC). Amplification was carried out with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA 02451, USA) at standard reaction conditions on the Viia7 instrument (Thermo Fisher Scientific, Waltham, MA 02451, USA). All reactions were conducted in triplicate. The allelic content of the Tmem70 transgene was calculated by the 2^−ΔΔCt relative quantification method using Quant Studio software (Thermo Fisher Scientific, Waltham, MA 02451, USA).

Genomic DNAs of brain, lung, and liver were isolated with Invisorb Spin Tissue Mini Kit (Stratec Molecular, Berlin) following the manufacturer's protocol. DNA Damage Quantification Kit (AP Sites) was used to quantitate apurinic/apyrimidinic (AP) sites in tissue of interest. The aldehyde reactive probe (ARP) that reacts specifically with an aldehyde group on the open ring form of AP sites (ARP-derived DNA) was detected with Streptavidin-Enzyme Conjugate. The quantity of AP sites in unknown DNA sample of brain, lung, and liver was determined using POLARstar Omega Reader at 450 nm by comparing standard curve of predetermined AP sites. All unknown DNA samples and standard were assayed in duplicate.

Oxiselect Total Glutathione Assay Kit, Oxiselect TBARS Assay Kit (MDA Quantification), Oxiselect Superoxide Dismutase Activity Assay, and Oxiselect Oxidative DNA Damage (AP Sites) were purchased from Cell Biolab, Inc. (San Diego, CA), while Invisorb Spin Tissue Mini Kit was purchased from Stratec Molecular (Berlin, Germany).

DNA was extracted from individual sand fly samples using an Invisorb Spin Tissue Mini Kit (STRATEC Molecular, Berlin, Germany), following the manufacturer’s instructions. The sand flies were lysed in a 200 µL lysis buffer containing 20 µL of proteinase K. At the final step, DNA was eluted in a 40 µL of elution buffer. The extracted DNA samples were kept at −80 °C for long-term storage.