Sybr green pcr assay kit

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from C2C12 cells. Reverse transcript cDNA was established by using the GoScript Reverse Transcription System (Promega, Madison, WI, USA), and an SYBR Green PCR Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to perform quantitative real-time PCR following the manufacturers’ protocols. All of the mRNA levels were normalized to GAPDH expression. Primers used in this experiment were: MT1 (Forward: AAGAGTGAGTTGGGACACCTT; Reverse: CGAGACAATACAATGGCCTCC); MT2 (Forward: ATGCAAATGTACTTCCTGCAAGA; Reverse: CTGGGAGCACTTCGCACAG); MT3 (Forward: TGCACCTGCTCGGACAAAT; Reverse: CCTTGGCACACTTCTCACATC); GAPDH (Forward: AATGGATTTGGACGCATTGGT; Reverse: TTTGCACTGGTACGTGTTGAT).

William’s E medium, fetal bovine serum (FBS), trypsin-EDTA, L-glutamine and RPMI medium were obtained from Lonza (Belgium, USA). Collagenase I, sodium tripolyphosphate (TPP), BSA, Ellman’s reagent, pyrazole, NAD⁺, propionaldehyde, 2′,7′-dichlorodihydrofluorescein diacetate (DCFH₂-DA), Annexin V-biotin, propidium iodide (PI), streptavidine fluorescein, ethidium bromide and acridine orange were purchased from Sigma (St Louis, USA). Chitosan and sodium DDC were from Acros Organics (New Jersey, USA). Gene JET RNA purification kit, cDNA synthesis kit and SYBR-green PCR assay kit were from Thermo Fisher Scientific (Waltham, Massachusetts, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD133 was obtained from BioLegend (San Diego, USA).