LCLs were resuspended in TRI reagent® (Molecular Research Center, Inc.), mixed with 1/5 volume of chloroform, incubated for 3 min at room temperature and spun down at 12,000 × g. The transparent phase was separated and the RNA was precipitated with isopropanol and washed once with 75% ethanol. The RNA pellet was further air-dried and dissolved in H2O-DEPEC. Subsequently, cDNA was generated with the SuperScript® III Reverse Transcriptase (Technologies) according to the manufacturers protocol. Quantitative PCR (qPCR) was performed with a Rotor Gene RG3000A, Corbett Research using gene specific primer and the SensiMix™ SYBR® Hi-ROX Kit (Bioline). qPCR was performed with following oligonucleotides (Microsynth): Polλ(fwd)5′-CCTGTGCCCTGCTCTACTTC-3′ and Polλ(rev)5′-CTCAGCAGGTTCTCGGTAGG-3′; Cdc6(fwd)5′-GGGAATCAGAGGCTCAGAAG-3′ and Cdc6(rev)5′-CACTGGATGTTTGCAGGAGA-3′; L28(fwd)5′-GCAATTCCTTCCGCTACAAC-3′ and L28(rev)5′-TGTTCTTGCGGATCATGTGT-3′. Results were normalized against L28 expression.
Rotor gene rg 3000a
Manufactured by Qiagen
Sourced in Japan, Australia, United Kingdom, Germany
The Rotor-Gene RG-3000A is a real-time PCR system designed for nucleic acid quantification and analysis. The system employs a unique tube rotor design that provides rapid, high-throughput thermal cycling and fluorescence detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Sybr green pcr kit, by Toyobo (6 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
M mlv reverse transcriptase kit, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Kapa sybr fast universal 2 qpcr master mix, by Roche (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Superscript 2, by Thermo Fisher Scientific (3 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Kapa sybr fast, by Merck Group (2 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taqtm 2, by Takara Bio (2 mentions)
Oligo dt, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Sensimix sybr hi rox kit, by Meridian Bioscience (1 mentions)
Tri reagent, by Molecular Research Center (1 mentions)
Superscript 3 reverse, by Thermo Fisher Scientific (1 mentions)
Sybr green mix kit, by Takara Bio (1 mentions)
Superscript 3 first strand cdna synthesis system, by Thermo Fisher Scientific (1 mentions)
Bioruptur, by Diagenode (1 mentions)
26 protocols using rotor gene rg 3000a
1
Quantitative PCR Analysis of Gene Expression
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Invitrogen), treated with DNase and cDNA synthesised from 1 µg of RNA using Superscript III reverse transcriptase (Invitrogen). Quantitative PCR was performed using a RotorGene RG3000A instrument (Corbett Research, Australia). Reactions consisted of 1 µL template cDNA, 5 µL Kapa SYBR FAST Universal 2×qPCR Master Mix (Kapa Biosystems, South Africa), and 200–900 nM of each primer in a final volume of 10 µL. Amplification conditions included an initial step at 95°C for 3 min, followed by 40 cycles of 95°C for 3 s, primer annealing at 60 or 65°C for 20 s and elongation at 72°C for 1 s. Melt curve analysis confirmed that the individual amplified products corresponded to a single, gene-specific cDNA fragment. The relative expression level of each gene of interest was calculated with the RotorGene 6000 series software v1.7 using the two standard curve method, with normalisation to the reference gene Actin-2 (At3g18780). Details of the primers used and specific qPCR reaction conditions can be found in Table S1 .
3
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified with TRIzol reagent (Life Technologies). 1 μg total RNA was primed with random hexamers and reverse transcribed into cDNA using MultiScribe Reverse Transcriptase (Life Technologies). Amplification of samples without reverse transcriptase assured the absence of genomic or plasmid DNA (data not shown). The relative transcription levels were determined by normalization to GAPDH or β-actin mRNA levels, as indicated. qRT–PCR was performed with KAPA SYBR FAST (Sigma-Aldrich) on Rotor-Gene RG-3000 A (Corbett Research). Primer sequences are listed in Table S10.
Table S10
4
Quantitative Analysis of PRPF40A Expression in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from 12 pairs of pancreatic cancer tissues were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcription (RT) reactions were performed using random primers and an M-MLV Reverse Transcriptase kit (Invitrogen). Real-time PCR was performed using the standard protocol included with the SYBR Green PCR kit (Toyobo, Osaka, Japan) on a Rotor-Gene RG-3000A (Corbett Life Science, Sydney, NSW, Australia). GAPDH was used as a reference. The primer sequences used for the detection of PRPF40A and GAPDH are shown in Table 1 . The ΔCt values were normalized based on the GADPH levels. Each sample was analyzed in triplicate.
Primer sequence used for mRNA detection
| Primer name | Forward primer | Reverse primer |
|---|---|---|
| PRPF40A | 5ʹ-ACACCTGCTGAGCAACTCTTA-3’ | 5ʹ-TGGCCCAGCGAGATTCTTTTG-3’ |
| GAPDH | 5ʹ-GGAGCGAGATCCCTCCAAAAT-3’ | 5ʹ-GGCTGTTGTCATACTTCTCATGG-3’ |
5
Quantitative Real-Time PCR of GPC1 in PANC-1 and 293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from PANC-1 and 293T cells was obtained by Trizol (Invitrogen), respectively, and then reverse transcription of RNA was performed using PrimeScript™ RT reagent Kit (Takara, Dalian, China). The qRT-PCR was carried out by the SYBR Premix Ex Taq TM II (Takara) on Rotor-Gene RG-3000A (Corbett Life Science, Sidney, Australia). The PCR primers for GPC1 sense primer was 5′-TACAGAGGAGGCCTCAAAGC-3′ and antisense primer was 5′-GGCATCATGCATCATCTCAG-3′; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense primer was 5′-GTGGATCAGCAAGCAGGAGT-3′ and antisense primer was 5′-AAAGCCATGCCAATCTCATC-3′. The PCR parameters were set as follows: 95°C for 10 min, 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 15 s. GAPDH were served as the internal control, and data were analyzed with 2-ΔΔCt method.
6
Quantifying miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CMs using Trizol reagent (Invitrogen, USA). Quantitated RNA (500ng) was used for generating cDNA by using M-MLV reverse transcriptase with special stem-loop primer for miRNAs and oligo-dT for mRNAs. Real-time PCR was performed using a standard protocol from the SYBR Green Mix kit (Takara, Dalian, China) on a Rotor-Gene RG-3000A (Corbett Life Science, Sydney, Australia). U6 small nuclear RNA and Gapdh were used as references. Each sample was analyzed in triplicate. The 2−ΔΔCt method was used to determine the relative quantitation of gene expression. Primers used in the amplification reaction were shown in Supplementary Table 1 .
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified with TRIzol reagent (Life Technologies). 1 µg total RNA was primed with random hexamers and reverse‐transcribed into cDNA using MultiScribe™ Reverse Transcriptase (Life Technologies). Amplification of samples without reverse transcriptase assured the absence of genomic or plasmid DNA. The relative transcription levels were determined by normalization to GAPDH mRNA levels. qRT–PCR was performed with KAPA SYBR® FAST (Sigma) on Rotor‐Gene RG‐3000 A (Corbett Research). Primer sequences are listed in Table 1 .
8
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using Trizol reagent (Invitrogen), and the reverse-transcription reactions were performed using an M-MLV Reverse Transcriptase kit (Invitrogen). The gene-specific stem–loop RT primers for miRNAs, which were released by the Sanger Institute, were designed according to Chen et al. Real-time PCR was performed using a standard SYBR Green PCR kit (Toyobo, Osaka, Japan) and a Rotor-Gene RG-3000A (Corbett Life Science, Sydney, New South Wales, Australia) according to the instructions from the respective manufacturer. GAPDH was used as references for miRNAs and RNAs, respectively. Each sample was analyzed in triplicate. The 2DDCt method was used to quantify the relative levels of gene expression.
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were dissected, frozen in TRIzol, and stored at −80 °C until processing. Total RNAs were extracted and 3 μg of total RNA was reverse-transcribed using the SuperScript III First-Strand cDNA Synthesis System (Invitrogen). Control reactions without reverse transcriptase were done in parallel. qRT-PCR was performed on ROTOR-GENE RG-3000A (Corbett research) using the SYBR green Premix Ex Taq system (TaKaRa) according to the manufacturer’s instructions with specific primers shown in Supplemental Table 1 .
10
Quantifying INPP4B Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from the cultured cell lines were extracted using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcription reactions were performed using random primers and an M-MLV Reverse Transcriptase kit (Invitrogen). Quantitative real-time PCR was then performed to amplify the cDNAs with the SYBR Green PCR kit (Toyobo, Osaka, Japan) on a Rotor-Gene RG-3000A (Corbett Life Science, Sydney, NSW, Australia). INPP4B expression levels were quantified using the 2−ΔΔCt method. GAPDH was used as the internal control. The primers for INPP4B were 5′‐GCCGACCACATCACCACAG‐3′ (forward) and 5′‐TTTCCGCTCACACTTTCCG‐3′ (reverse) and the primers for GAPDH were 5′‐TCAGCCGCATCTTCTTTTGC‐3′ (forward) and 5′‐GCGCCCAATACGACCAAATC‐3′ (reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!