Hybrid r

Total RNAs from 13 human and 10 mouse tissues were purchased from Clontech (Clontech, USA). Total RNA was extracted by using Hybrid-R (GeneAll, Republic of Korea) from 14 tissue samples of female crab-eating monkey, provided from the National Primate Research Center, KRIBB, following the manufacturer’s instructions. The Primate Research Institute provided the male western chimpanzee samples, and the female western chimpanzee samples were supported from the Kumamoto sanctuary, Kyoto University to Primate Research Institute in Inuyama, Japan, via GAIN. The experiments handling with western chimpanzee samples was taken at Primate Research Institute. The 11 western chimpanzee male and female tissues were used to extract total RNA using Hybrid-R (GeneAll, Republic of Korea).
The RNA samples quantitated by spectrophotometer, ND-1000 UV–Vis (NanoDrop, USA). The RNA was quantified as 500 ng, and reverse transcribed at the mRNA level using a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Japan), and the miRNA levels were determined using the HB miR Multi Assay Kit system I (HeimBiotek, Republic of Korea).

Total RNA was isolated from the olfactory epithelium and thalamus of BALB/c mice, as well as from ANO2-EGFP-transfected and untransfected NIH/3T3 cells, using an RNA isolation kit (Hybrid-R, GeneAll, Korea). One microgram of total RNA was used for cDNA synthesis with the SuperScript III First-Strand Synthesis System for RT–PCR (Invitrogen). PCR primers used to confirm expression were as follows: β-actin; F1 primer 5′-TGTGATGGTGGGAATGGGTCAGAA-3′ and R1 primer 5′-TGTGGTGCCAGATCTTCTCCATGT-3′ to produce a 140 bp cDNA; ANO2, F2 primer 5′-AGAGCCTTACACTGGGCTGA-3′ and R2 primer 5′-GTCCCGTTGTGGCTATAGGA-3′ to produce a 321 bp cDNA. PCR conditions were as follows: 5 min at 94 °C for one cycle, and then 35 cycles of 30 s at 94 °C, 30 s at 60 °C, 1 min at 72 °C, followed by 5 min at 72 °C.

Total RNA was isolated by using Hybrid-R™ (GeneAll, Seoul, Korea). The RNA was reverse transcribed using a ReverTra Ace qPCR RT Master Mix (TOYOBO, Osaka, Japan) to generate cDNA. The viral copy numbers were determined by real-time PCR (RT-PCR) with an L segment-based SFTSV-specific primer. The forward primer sequence was SFTSV-L-F: AACATCCTGGACCTTGCATC and the reverse primer sequence was SFTSV-L-R: CAATGTGGCCATCTTCTCCA [17 (link)]. Copy numbers were determined by comparison to a standard control. RT-PCR was performed using CFX96 Real-time PCR (Bio-Rad Laboratories, Hercules, CA) with qPCR SyGreen Mix (PCRbiosystems, Seoul, Korea).