Embryomax ksom medium

To perform in vitro fertilization (IVF), the cauda epididymis of male ICR mice (ten weeks old) was dissected and placed immediately into the human tubal fluid (HTF) medium supplemented with 4 mg/mL BSA for 1 h in a CO₂ incubator (37 °C and 5% CO₂) for sperm capacitation. After sperm capacitation, the collected MII oocytes from different groups were transferred to HTF medium containing 1–2.5 × 10⁶ capacitated spermatozoa and incubated for 6 h in a CO₂ incubator (37 °C and 5% CO₂). After insemination, the embryos were transferred to the Embryo^Max KSOM medium (MR-020P-D, Sigma, Shanghai, China), which was supplemented with 1 mg/mL of BSA and covered by mineral oil in a 35 mm sterile plate (Corning). The embryos were cultured in vitro for 3.5 d. During this period, the embryonic developmental stages (2-cell embryo, 8-cell embryo and blastocyst stage) of different groups were microscopically observed and recorded with the embryonic development rates calculated as percentage of embryo/fertilized oocytes.

For ICAHCI, DKO-AG-haESCs arrested at M phase by culturing in ESC medium containing 0.05 μg/ml demecolcine (Sigma-Aldrich, USA) for 8 hours were used for intracytoplasmic injection. The synchronized AG-haESCs were trypsinized, washed 3 times with HEPES-CZB medium, and suspended in HEPES-CZB medium containing 3% (w/v) polyvinylpyrrolidone. Each nucleus from M-phase haploid cells was injected into an MII-arrested oocyte using a Piezo-drill micromanipulator. The reconstructed oocytes were cultured in CZB medium for 1 hour and then activated for 5 to 6 hours in activation medium without CB. Following activation, all of the reconstructed embryos were cultured in EmbryoMax KSOM Medium (Sigma-Aldrich, MR-106-D, USA) at 37°C under 5% CO₂ in air until the two-cell stage. For embryo transplantation, 17 to 20 reconstructed two-cell embryos were transferred into each oviduct of a pseudopregnant ICR female at 0.5 days post coitum (dpc). SC pups were naturally delivered or removed from the uteri of their euthanized recipient mothers at 19.5 dpc. After cleaning fluid from their air passages, the pups were kept in a warm box supplied with oxygen.

The mixture of NG-ABEmax or NG-ABEmax-KR mRNA (100 ng/μl) and sgRNA (100 ng/μl) was diluted in RNase-free water, centrifuging at 4 °C, 13,400 g for 10 min and then injected into the cytoplasm of zygotes harvested from B6D2F1 females (mated with C57BL/6 males) using a micromanipulator (Olympus) and a FemtoJet microinjector (Eppendorf). The injected embryos were cultured in EmbryoMax KSOM Medium (Sigma-Aldrich) for 24 h to the two-cell embryos and 84 h to the blastocysts. Some two-cell embryos were transferred into oviducts of recipients at 0.5 days postcoitum (dpc). Recipient mothers delivered pups at 19.5 dpc and we analyzed phenotypes of offspring at day 10 after birth.

B6J-RNF213em1Irc mice were generated using the CRISPR/Cas9 system. Synthetic Alt-R® CRISPR-Cas9 crRNA (Integrated DNA Technologies) with protospacer sequences 5’ CAGAGCTTCGGAACTTTGCT 3’ and 5’ TGTGCCCCTCATCAACCGTC 3’ were duplexed with synthetic Alt-R® CRISPR-Cas9 tracrRNA (Integrated DNA Technologies). cr/tracrRNA duplexes (100 ng/µl) were complexed with Alt-R® S.p. Cas9 Nuclease V3 (500 ng/µl) (Integrated DNA Technologies). The resulting RNP complex was electroporated into C57BL/6 J zygotes using a Nepa21 electroporator with electrode CUY501P1-1.5 using following electroporation parameters: poring pulse = 40 V; length 3.5 ms; interval 50 ms; No. 4; D. rate 10%; polarity+ and transfer pulse = 5 V; length 50 ms; interval 50 ms; No. 5; D. rate 40%; polarity±. Electroporated embryos were incubated overnight in Embryomax KSOM medium (Merck, Millipore) in a CO2 incubator. The following day, two-cell embryos were transferred to pseudopregnant B6CBAF1 foster mothers. The resulting pups were screened by PCR over the target region using primers 5’ AGTTTCTTGATCTCTTCCCC 3’ and 5’ CTCCTCCGTCAGATCCCTA 3’. PCR bands were Sanger sequenced to identify the exact nature of the deletion. Mouse line B6J-RNF213em1Irc contains an allele with a deletion of 2854 bp (chr11+: 119440493-119443346) in exon ENSMUSE00000645741 resulting in a frameshift and premature stopcodons (Supplementary Fig. 11).

FGOs were collected by punching the ovaries of female mice at 3–4 weeks of age. Wild-type, control, K36M, Setd2 KO, and DM FGOs were obtained from C57BL6/J, H3f3b^K36M-flox/+, (H3f3b^K36M-flox/+; Gdf9-Cre), (Setd2^flox/flox; Zp3-Cre), and (H3f3b^K36M-flox/+; Setd2^flox/flox; Gdf9-Cre) females, respectively. Both Gdf9 and Zp3 promoters are oocyte-specific, but, for the H3f3b^K36M-flox allele, Gdf9-Cre worked more efficiently, perhaps because it starts to be expressed earlier during oogenesis^{29 (link)}. The primers used for genotyping are listed in Supplementary Table 4. For super-ovulation, females were injected with 0.1 ml of CARD HyperOva (Kyudo) and 46–48 h later, with 5 IU of hCG (ASKA Pharmaceutical). Cumulus-oocyte complexes were collected from the oviducts, and in vitro fertilization was performed with either C57BL/6 J or JF-1 sperm. Zygotes were cultured in EmbryoMax KSOM medium (Merck Millipore) at 37 °C under 6% CO₂ in the air. Late two-cell embryos were harvested at 31–32 h postfertilization (hpf) and blastocysts at 120 hpf.

For all embryo culture groups, embryos were flushed from the oviducts with warm HEPES-buffered MEM and washed in a minimum of four drops of EmbryoMax KSOM medium (1x) containing ½ amino acids (KSOM + AA, EMD Millipore) covered in mineral oil, and cultured to the appropriate stage in a final KSOM + AA droplet under mineral oil at 37°C in an atmosphere of 5% CO₂, 5% O₂, 90% N₂.
For the one-cell to morula culture group (1-cell-morula), eggs were fertilized in vivo and the embryos were flushed from the oviducts 24 h after hCG injection. Embryos were then cultured for 2.75 d prior to transfer. The four-cell to morula culture group (4-cell-morula) contained some four- and five-cell embryos but the vast majority of embryos were six-cells at collection. Embryos were flushed from the oviducts 68 h after hCG injection, washed, and cultured for 24 h before transfer. For morula-blastocyst culture group, embryos were flushed from the oviducts 72 h after hCG injection, and cultured to the blastocyst stage for 24 h before transfer. For the one-cell to blastocyst group (1-cell-blastocyst), embryos were flushed from the oviducts 24 h after hCG injection, and cultured to the blastocyst stage for 96 h before transfer. For all culture groups, embryos were left to develop undisturbed from the beginning of culture until embryo transfer.