Vav icre mice

C57 BL/6, CD45.2, CD45.1 mice were purchased from Charles River, Inc. DPP4 flox/flox mice were obtained by breeding targeted C57Bl/6NTac-DPP4tm1a Wtsi/Ics mice (European Mouse Mutant Cell Repository, EUCOMM) with 129S4/Bl6-Gt(ROSA) 26Sortm2(FLP*)Sor/J (stock #012930, The Jackson Laboratory, Bar Harbor, ME). The offspring were then crossed with Vav-iCre mice (stock #018968, The Jackson Laboratory, Bar Harbor, ME) (de Boer et al., 2003),^{56 (link)} to obtain DPP4 ^fl/fl;Vav-Cre mice. All mice were cared for in accordance with National Institutes of Health guidelines. No statistical method was used to predetermine the sample size. Mice were randomly assigned to the experiments after genotyping with the same sex, similar age group (6–8 weeks old) and approximately same weight. The investigators were not blinded to the allocation of animals during the experiments and outcome assessment. All procedures were approved in advance by the Institutional Animal Care and Use Committee of the University of Missouri.

Wild-type C57BL/6J mice (Stock no. 000664), Vav-icre mice (Stock no. 008610), R26-CreErt2 mice (Stock no. 008463), Il22ra1-floxed (Stock no. 031003), CD45.1 C57BL/6J mice (Stock no. 002014), Trp53−/− (Stock no. 002101), Cd4-cre (Stock no. 022071), and Apc^Min (Stock no. 002020) mice were purchased from The Jackson Laboratory. Il22^−/− mice were provided by R. Caspi (National Institutes of Health, Bethesda, MD) with permission from Genentech (San Francisco, CA). Epor-cre⁵³ mice were a gift from U. Klingmüller (Deutsches Krebsforschungszentrum (DFKZ), Germany). Il22-tdtomato (Catch-22)⁵⁴ mice were a gift from R. Locksley (University of California at San Francisco, CA). Rps14-floxed mice⁵⁵ were a gift from B. Ebert (Dana-Farber Cancer Institute, Boston, MA). Mice were housed in the Animal Research Facility (ARF) at DFCI under ambient temperature and humidity with 12 h light/12 h dark cycle. Animal procedures and treatments were in compliance with the guidelines set forth by the Institutional Animal Care and Use Committee (IACUC) at DFCI. Age- and gender- matched mice were used within experiments.

We used wild-type C57BL/6 (CD45.2) and C57BL/6.SJL (CD45.1) mice 6–12 weeks of age. Dnmt3a^fl/fl mice, a kind gift from Dr. Margaret Goodell, were crossed to either Mx1-Cre mice (Stock No: 003556) or Vav-iCre mice (Stock No: 008610) obtained from Jackson Labs. Dnmt3a^fl/fl Ifngr1 DKO mice were produced by mating Mx1-Cre Dnmt3a^fl/fl with Ifngr1^−/− mice (Stock No: 025394) all on C57BL/6 background. Dnmt3a^+/− germline heterozygous mice were also received from the Goodell lab. Batf2-KO mice were generated in conjunction with the genetically engineered mouse core facility at BCM by the use of CRISPR gene editing to remove exons 1 and 2 of Batf2 in a C57BL/6 background. Heterozygous mice from the initial transfer were outcrossed to WT mice and F1 pups were then crossed to generate homozygous mice. Genotyping was determined by PCR and sequencing. The following CRISPR single guide RNAs were used: GGTGCACTCACTCGCACTCGCTC and GGTCTCACTCTTGGTTCAAAAGG. All mice were maintained at an AALAC-accredited, specific pathogen-free animal facility at Baylor College of Medicine. All experiments were approved by the institutional review board of Baylor College of Medicine.

C57BL/6 mice (The Jackson Laboratory), Wnt1-Cre mice (Danielian et al., 1998 (link)), Tie2-Cre mice (Kisanuki et al., 2001 (link)), Cdh5-BAC-Cre^ERT2 mice (Okabe et al., 2014 (link)), Vav-iCre mice (The Jackson laboratory, (Georgiades et al., 2002 (link)), Vav-Cre^ER mice (Herold et al., 2014 (link)), CD11b-Cre mice (Boillee et al., 2006 (link)), Csf1r-iCre mice (The Jackson laboratory, (Deng et al., 2010 (link)), Csf1r-MER-iCre-MER mice (The Jackson laboratory, (Qian et al., 2011 (link)), LysM-Cre mice (The Jackson laboratory, (Clausen et al., 1999 (link)), WT1-Cre mice (Wessels et al., 2012 (link)), R26R (The Jackson laboratory, (Soriano, 1999 (link)), R26R^EYFP mice (The Jackson laboratory, (Srinivas et al., 2001 (link)), Ai14 mice (The Jackson laboratory, (Madisen et al., 2010 (link)), PU.1^−/− mice (Scott et al., 1994 (link)), Csf1^op/op mice (The Jackson laboratory, (Yoshida et al., 1990 (link)) and Tgfbr2^flox mice (The Jackson laboratory, (Leveen et al., 2002 (link)) have been reported elsewhere. All experiments were carried out according to the guidelines approved by the National Heart, Lung, and Blood Institute Animal Care and Use Committee.

The floxed col1a1 mice in a C57/Bl6 background are previously described(37 (link)). Vav-iCre mice are from Jackson Laboratories(38 (link)). Type I collagen-GFP (Col-GFP) reporter mice are previously described(39 (link)). Mice were genotyped by PCR. Six to eight week-old mice were given 50 µl intratracheal injections of saline or bleomycin (2 units/kg) dissolved in saline via surgical tracheotomy(37 (link)). At various time points after injection, mice were euthanized and samples collected for analysis. All mice were bred and maintained in a specific pathogen-free environment and all animal experiments were approved by the University Animal Care and Use Committee at University of Michigan.