Abi 7500 multi color real time pcr detection system

Real time PCR was done as described previously¹ . Briefly, total RNA was harvested and subjected to random-primer reverse transcription using the Superscript III system (Invitrogen/Life Technologies, Grand Island, NY, USA). Real time PCR analysis was performed using iTaq SYBR Green supermix (172-5121, Bio-Rad, Hercules, CA, USA) or Taqman (for CXCL1 only; Applied Biosystems, Foster City, CA, USA) in ABI 7500 multicolor real time PCR detection system (Applied Biosystems). Standard curves were performed and efficiencies determined for each set of PCR primer pairs used with the iTaq SYBR Green method, including the housekeeping gene, GUSB. Efficiencies were: 93% (GUSB), 101% (IL8), 95% (IL6) and 96% (ICAM1). Primer sequences were: GUSB Forward (CAGGACCTGCGCACAAGAG), GUSB Reverse (AGCGTGTCGACCCCATTC), IL8 Forward (CTTGGCAGCCTTCCTGATTT), IL8 Reverse (TTCTTTAGCACTCCTTGGCAAAA), IL6 Forward (TGCAGATGAGTACAAAAGTCCTGAT), IL6 Reverse (GTGGTTATTGCATCTAGATTCTTTGC), ICAM1 Forward (GCCAGGAGACACTGCAGACA) and ICAM1 Reverse (TGGCTTCGTCAGAATCACGTT).