The rat KCNA2 clone was used in the pMAX vector. Mutations F302L and/or A291C [for voltage clamp fluorometry (Horne et al. 2010 (link)); see below] were generated and confirmed by sequencing. The plasmid was linearized using PacI (New England Biolabs, Ipswich, MA, USA); cDNA (1 μg) was transcribed to cRNA in vitro (mMESSAGE MACHINE, Thermo Fisher Scientific) and stored at −80°C in RNA storage solution (Thermo Fisher Scientific).
Mmessage machine
Manufactured by Thermo Fisher Scientific
Sourced in United States
The MMessage Machine is a laboratory equipment designed for cell culture applications. It provides a controlled environment for the delivery of messages or signals to cells in culture. The core function of the MMessage Machine is to facilitate the controlled and consistent introduction of desired messages or signaling molecules to cultured cells, enabling researchers to study cellular responses and behaviors.
Automatically generated - may contain errors
Lab products found in correlation
Rna storage solution, by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Zsyne1b, by Gene Tools (1 mentions)
Znup43, by Gene Tools (1 mentions)
Znup37, by Gene Tools (1 mentions)
P53 morpholino, by Gene Tools (1 mentions)
Control morpholino, by Gene Tools (1 mentions)
Morpholino oligonucleotides mos, by Gene Tools (1 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (1 mentions)
16 protocols using mmessage machine
1
Rat KCNA2 clone mutagenesis protocol
2
EEEV Virus Production and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macaques were infected via aerosol with EEEV alphavirus strain V105, derived from a cDNA clone based on GenBank accession number KP282670. V105 was originally isolated in 2005 from the brain of a fatal human case during an outbreak in Massachusetts [32 (link), 33 (link)]. Viruses were produced initially by full-length, capped genome synthesis from linearized cDNA clones (mMessage Machine, Thermofisher) and electroporation of 10–20 μg of RNA into BHK 21 cells. Supernatants were harvested at 18–24 hours after electroporation and used to infect 1900 cm2 roller bottle cultures of Vero cells. At 18–24 hours after infection, Vero cell supernatants were harvested and subjected to low speed clarification prior to loading onto a 20%/60% discontinuous sucrose gradient in TNE buffer (10 mM Tris, 10 mM EDTA, 2 M NaCl, pH 7.4) and centrifugation for 3.5 hours at 24,000 RPM. The virus-containing interface was then harvested and virus particles were pelleted over a 20% sucrose (in TNE) gradient for 18–24 hours at 24,000 rpm. Pelleted virus was resuspended in Opti-MEM (Gibco 31985–070) and stored at -80 °C. Individual lots of virus were tested for virulence by aerosol dose-step infection of CD-1 mice and approved for NHP use only after typical virulence in mice (EEEV V105 LD50 ~200 PFU) was verified.
3
Inhibition of Ryanodine Receptors in Zebrafish
4
Generation of HCN2 Channel Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA plasmid containing the sequence of WT mouse HCN2 (mHCN2) channel was provided by S. Siegelbaum (Columbia University, New York, NY). The HCN2-SOG and HCN2-EGFP constructs were made by inserting the DNA sequence encoding 1O2 generator (SOG) or EGFP at the C terminus of the CNBD through the BsmI cut site, flanked by the CNBD and the downstream sequence of the mHCN2 channel (Figs. S2 and S3 ). The H434A mutation was introduced by a two-step PCR method. DNA plasmids were linearized by SphI and purified by phenol-chloroform extraction. mMessage machine (Ambion) was used to make cRNA. 40–50 ng cRNA was injected into each oocyte at stage VI. Injected cells were cultured between 16 and 18°C for 2–4 d before experiments.
5
Splice-blocking antisense morpholino knockdown
6
Xenopus Embryo Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
Xenopus laevis embryos from induced spawning were staged according to Nieuwkoop and Faber (1967). Embryos were fertilized in vitro and dejellied using 1.8% L-cysteine, pH 7.8, then maintained in 0.1x Marc's Modified Ringer's (0.1xMMR). Microinjections were performed in 4% Ficoll in 0.3xMMR according to established protocols. Capped mRNAs were in vitro transcribed using mMessage machine (Ambion). The injections amounts per embryo were the following: GFP tagged 40LoVe, Samba and hnRNP AB and protein mutants 100 pg –200 pg, Rescue constructs of 40LoVe, Samba and hnRNP AB 80 pg. After the injections the embryos were cultured in 4% Ficoll in 0.33x MMR until stage 8 and then cultured in 0.1x MMR at room temperature.
+ Expand
Xenopus laevis embryos from induced spawning were staged according to Nieuwkoop and Faber (1967). Embryos were fertilized in vitro and dejellied using 1.8% L-cysteine, pH 7.8, then maintained in 0.1x Marc's Modified Ringer's (0.1xMMR). Microinjections were performed in 4% Ficoll in 0.3xMMR according to established protocols. Capped mRNAs were in vitro transcribed using mMessage machine (Ambion). The injections amounts per embryo were the following: GFP tagged 40LoVe, Samba and hnRNP AB and protein mutants 100 pg –200 pg, Rescue constructs of 40LoVe, Samba and hnRNP AB 80 pg. After the injections the embryos were cultured in 4% Ficoll in 0.33x MMR until stage 8 and then cultured in 0.1x MMR at room temperature.
7
Morpholino Knockdown and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
P53 morpholino, bid morpholino and control morpholinos were purchased from Gene Tools LLC (all the sequences are listed in Table S1) . Capped mRNAs (bcl2-mCherry) were transcribed from linearized PCS2+ plasmids (mMessage Machine; Ambion), purified, and diluted to 100 ng/ml for injection at the 1-cell stage of development.
8
Zebrafish Sema3f Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was subcloned from plasmid constructs gifted by C. Moens (University of Washington, Seattle, Washington, USA) containing full-length zebrafish sema3fa and sema3fb in pCR4 vectors, RNA transcribed by mMessageMachine (Ambion) and microinjected into one-cell-stage embryos. All MOs were from Genetools. One-cell-stage embryos were microinjected with pre-mRNA translation blocking MO to sema3fa (17 (link)) or splice blocking MO targeting the exon3/5 boundary of sema3fb, 5′TATGAAGCGATACTCACGTTTGTGT3′. Efficacy of sema3fb knockdown was confirmed by RT-PCR (Supplemental Figure 2 ). The control MO was CCTCTTACCTCAGTTACAATTTATA.
9
Whole-embryo microRNA sensor assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-embryo microRNA sensor assay in zebrafish was carried out as described previously [17 (link)]. The coding sequences of EGFP and mCherry were cloned into the pCS2 + vector. The pCS2+-EGFP-sema4c-3′-UTR construct was generated by cloning 1121 bp 3′-UTR of the zebrafishmib1Mrna (ENSDARG00000079611) into the pCS2+EGFP vector, whereas pCS2+EGFP-sema4c-3′-UTR (MUT) was generated by inserting only nucleotides 611 bp of the sema4c mRNA, which lacks the fragments containing the miR-10 targeting sites. sema4c 3′-UTR and mut sema4c 3′-UTR were inserted between the EcoRI-XhoI restriction sites in the multiple cloning regions downstream of the EGFP gene. The following two pairs of primers were used for cloning the insertion fragment:
sema4c-3′-UTR- EcoRI-left:
5′ -CCGGAATTCTGTGGTAGTTGAGGTGCTATCT -3′;
sema4c-3′-UTR-XhoI-right:
5′- CCGCTCGAGACAGTGTGAGCCAGCCTTAA -3′;
sema4c (mut)- 3′-UTR-EcoRI-left:
5′- CCGGAATTCTTGTGGTAGTTGAGGTGCTATC -3′;
sema4c (mut)- 3′-UTR-XhoI-right:
5′-CCGCTCGAGACTGGGCCTAATACACTATTGT-3′.
The pCS2+-mCherry vector was used as a control. These three plasmids were linearized with Not1/Kpn1 and used as templates to synthesize the capped mRNAs using mMessage Machine (Ambion). The RNAs were injected into single cell stage embryos as described previously (35 pg per embryo).
sema4c-3′-UTR- EcoRI-left:
5′ -CCGGAATTCTGTGGTAGTTGAGGTGCTATCT -3′;
sema4c-3′-UTR-XhoI-right:
5′- CCGCTCGAGACAGTGTGAGCCAGCCTTAA -3′;
sema4c (mut)- 3′-UTR-EcoRI-left:
5′- CCGGAATTCTTGTGGTAGTTGAGGTGCTATC -3′;
sema4c (mut)- 3′-UTR-XhoI-right:
5′-CCGCTCGAGACTGGGCCTAATACACTATTGT-3′.
The pCS2+-mCherry vector was used as a control. These three plasmids were linearized with Not1/Kpn1 and used as templates to synthesize the capped mRNAs using mMessage Machine (Ambion). The RNAs were injected into single cell stage embryos as described previously (35 pg per embryo).
10
Heterologous Expression of Ion Channels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs encoding HCN and CNG channels related to this study were cloned into the pGH19 vector and linearized by NheI (CNG and spHCN) and SphI (HCN). mMESSAGE machine (Ambion) was used for cRNA synthesis. 40–50 ng cRNA was injected into each oocyte at stage VI. After 1–2 d of incubation at 18°C, injected oocytes were selected for recording. For patch-clamp recording, the electrode solution (extracellular) and bath solution (intracellular) were symmetrical and contained 110 mM KCl, 2 mM NaCl, 10 mM HEPES, and 1 mM EDTA (pH 7.4 adjusted by KOH). All experiments were performed at room temperature.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!