Thunderbird next sybr qpcr

The cDNA was synthesized from 1 μg of total RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Molecular System Inc, Alameda, CA). Real-time PCR was performed on a LightCycler 96 system (Roche) using THUNDERBIRD Next SYBR qPCR (Toyobo, Osaka, Japan) as a detection reagent. Forward and reverse primer sequences respectively for the rat KCNH2 channel were designed from the sequence in the GenBank database as follows (accession numbers are indicated in parentheses): Kcnh2 (117018), forward 5’-TCAACCTGCGAGATACCAACATG-3’, reverse 5’-CTGGCTGCTCCGTGTCCTT-3’. Data were calculated by 2^-ΔΔCT and are presented as fold change induced in the transcript of each myocyte gene assayed by gemcitabine exposure. Gene expression was normalized to that of GAPDH and compared with the control condition (vehicle defined as 1.0).

ChIP-qPCR was performed using the SimpleChIP® Enzymatic Chromatin IP Kit (Cell Signaling Technology, #CST 9003 S) using the manufacturer’s protocol. For this experiment, cell lines derived from NSt cells (Supplementary Data 1) and expressing MCP-RFP and either TetR(W43F)-mNG, TetR(WT)-mNG, or NLS-mNG were used. Approximately 1 × 10⁷ cells were used per experiment, with 20% of each sample as input after MNase digestion. For immunoprecipitation, 2 μg of mouse anti-RPB1 unphosphorylated CTD antibody (CMA601, in house, 1:200) was used^{59 (link)}. DNA purified from immunoprecipitated chromatin was subjected to qPCR analysis using THUNDERBIRD Next SYBR qPCR (TOYOBO). Primer sets containing a positive control (Gapdh promoter) was used in the qPCR analysis (Supplementary Table 1). The Ct value of each sample was used to calculate % input from 2^[(Ct input −5.64) -Ct sample]×100. In addition, fold enrichment (% to Gapdh) was calculated by normalizing the % input values between samples by the Gapdh values.

Quantitative PCR (qPCR) was conducted to assess the enrichment of specific histone modifications in the WOW-CAT libraries. The qPCR mixture (total volume: 10 μL) was prepared as follows: 5 μL THUNDERBIRD Next SYBR qPCR (Toyobo, Osaka, Japan), 1 μL library DNA, and 0.3 μL (10 μM) forward/reverse primers. PCR was performed with a StepOnePlus Real-time PCR system (Life Technologies) using the following program: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 10 s with melt curve drawing. The primers used are listed in Table 1.
Table 1

Primers used for WOW-CAT-qPCR for sex identification

Gene	Primer sequence (5′–3′)	Product size (bp)
XIST	F: GGGTGGTAGAATCGGTCACA	71
	R: GGTAGCGAGGTGCTATGCTA
DDX3Y	F: GAAAGGCGCGAACTCTGTCT	94
	R: TTCCGGTAGACCAACCTGTG
MUS81	F: TCCAAAAGGCTGGTCCTGTC	70
	R: GGTTGGTACCGATCGCTGTA