Probe qpcr master mix

The extraction of virus DNA was carried out using the PureLinkTM Viral RNA/DNA Mini Kit (Thermo Fish Scientific Inc., Waltham, MA, USA), according to the manufacturer’s instruction. Cells were lysed with proteinase K, lysis buffer and ethanol. Then, the DNA was purified by centrifugation. Finally, 40 μL sterile RNase-free water elution of DNA was used. A total of 20 μL of the qPCR reaction system was prepared with probe qPCR Master Mix (Takara, Shiga, Japan). The final concentration of forward and reverse primers was 200 nM. The PCR thermal cycling program is as follows: 95 °C for 10 s and 58 °C for 40 s with the reaction cycle of 45. Fluorescence signals were recorded with a Roche LightCycler480. The HSV-1 primers were Forward, CGTCCCTGTCCTTTTTCCCA; Reverse, ACGTAGCACGGTAGGTCAC; Probe, AAGCATCGACCGGTCCGCGCTAGTT. We used an HSV-DNA polymerase plasmid dilution (10⁶ copies, 10⁵ copies, 10⁴ copies, 10³ copies, 10² copies and 10¹ copies) to generate the standard curve. Gene expression was calculated using the standard curve and CT value.