The largest database of trusted experimental protocols

14 protocols using oci ly7

1

Geniposide Regulates DLBCL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human DLBCL cell lines (OCI-LY7 and OCI-LY3) were previously purchased from the ATCC (Manassas, VA, USA) and maintained in our lab under standard culture conditions as previously mentioned16 (link). Normal B-lymphocytes were obtained from a healthy donor as previously described16 (link). The cells were treated with geniposide (Sigma-Aldrich, St. Louis, Missouri, USA) at the corresponding concentration.
HCP5 shRNA and nontargeting shRNA (NT shRNA) were provided by GenePharma (Shanghai, China). The miR-27b-3p mimics/inhibitor and negative control (NC) mimics/inhibitor were purchased from RIBOBIO (Guangzhou, China). The pcDNA3.1-MET was generated by inserting the cDNA product of MET into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA, USA). The transfection was performed with Lipofectamine 2000 (Invitrogen) following the manufacturer's protocols.
+ Open protocol
+ Expand
2

Cell Line Culturing and B Cell Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GCB subtype cell line OCI‐LY7 and ABC subtype cell line OCI‐LY3 were obtained from the ATCC. OCI‐LY7 and OCI‐LY3 cells were incubated in complete Iscove's modified essential medium (IMDM; GIBCO) supplemented with 10% foetal bovine serum (FBS; GIBCO). HEK293T cells were maintained in our laboratory and cultured under standard conditions. The cell culture medium was supplemented with 1% penicillin/streptomycin (Invitrogen). Cell culture was performed at 37°C in an atmosphere containing 5% CO2. Normal B lymphocytes were negatively selected from the peripheral blood of a 34‐year‐old healthy female using an immunomagnetic technique (Human B Cell Enrichment Kit, Stem Cell Technologies).
+ Open protocol
+ Expand
3

DLBCL Cell Line Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human DLBCL cell lines OCI-Ly7 and OCI-Ly3 were purchased from the ATCC. The cell lines were routinely cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 2.0 mM L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin. All cells were cultured in a humidified incubator at 37 °C with 5% CO2. The cells were transfected by using the transfection reagent Lip2000 in accordance with the manufacturer’s instructions. After transfection for 48 h, the cells were harvested for subsequent experiments.16 (link)
+ Open protocol
+ Expand
4

Maintaining Human DLBCL Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
WSU-DLCL2 (RRID:CVCL_1902), SU-DHL-6 (RRID:CVCL_2206) and OCI-LY7 (RRID:CVCL_1881) were purchased from ATCC (Manassas, USA). Human DLBCL cells were maintained in RPMI1640 with 10 % FBS and antibiotics at 37°C with 5 % CO2 as well as their GSK343 resistant clones (see below). All cell lines were passaged twice between thawing and use in experiments, and routinely tested to confirm absence of Mycoplasma contamination using e-Myco VALiD Mycoplasma PCR Detection Kit (FroggaBio). Culture media, FBS and antibiotics were purchased from Wisent (St Bruno, Canada). Drug information is listed in Table S1. Diluted compounds were kept at −80°C.
+ Open protocol
+ Expand
5

Culturing 16 DLBCL Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 16 DLBCL cell lines (DOHH2, HT, OCI-LY19, DB, OCI-LY1, SUDHL-4, SUDHL-5, SUDHL-10, NUDHL-1, OCI-LY7, WSU-DLCL2, SUDHL-6, NUDUL-1, U2932, OCI-LY3, and RI-1) were purchased from the American Type Culture Collection or from DSMZ (Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Germany). They were grown in RPMI-1640 Glutamax medium (Gibco, Invitrogen, Cergy Pontoise, France), supplemented with 10% fetal bovine serum (FBS) (PAA laboratory GmbH, Pasching, Austria) (U2932, SUDHL-4, HT, DOHH2, SUDHL-10, RI-1, and WSU-DLCL2 cells), 20% FBS (OCI-LY3, DB, SUDHL-5, NUDHL-1, and SUDHL-6 cells), or 15% FBS (NUDUL-1 cells). OCI-LY1, and OCI-LY7 cells were cultured in IMDM Glutamax (Gibco, Invitrogen, Cergy Pontoise, France), supplemented with 20% FBS, and OCI-LY19 cells in MEM alpha modified Glutamax (Gibco, Invitrogen, Cergy Pontoise, France) with 20% FBS. Cultures were maintained at 37 °C in a humidified atmosphere with 5% CO2. Contamination by Mycoplasma species was regularly monitored.
+ Open protocol
+ Expand
6

NLE1 Knockout in DLBCL Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lines of DLBCL including OCI-LY7, TMD8 and 293T were purchased from the American Type Culture Collection (ATCC). We packaged lenti-virus by 293T cell. The sgRNA targeting NLE1 or negative control as follow: NLE1-sg1: TGAGCCGATACAACCTCGTG; NLE1-sg3: ACTGACTATGCCCTGCGCAC; Nontarget-sg: ACGGAGGCTAAGCGTCGCAA. After knocking out the NLE1, we tested the proliferation by the EdU staining.
+ Open protocol
+ Expand
7

Comparison of GCB, ABC, and Embryonic Kidney Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell lines OCI-LY7, OCI-LY3 and HEK293T were obtained from American Type Culture Collection (ATCC). OCI-LY7 is germinal center B-cell (GCB)-subtype cell line; OCI-LY3 is an activated B-cell (ABC)-subtype cell line; and HEK293T is an embryonic kidney cell line. OCI-LY7 was maintained in complete Iscove’s modified essential medium (IMDM; GIBCO, Carlsbad, CA, USA) with 2-mercaptoethanol (1:10000) and 10% fetal bovine serum (GIBCO). OCI-LY3 was cultured in IMDM with 20% fetal bovine serum. HEK293T cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM; GIBCO) supplemented with 10% fetal bovine serum. All of the cell lines were supplemented with 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). All of the cell cultures were maintained at 37°C under 5% CO2 and 95% air.
+ Open protocol
+ Expand
8

Cell Culture Protocols for Lymphoblastoid and DLBCL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human lymphoblastoid B cell (GM12878), human renal epithelial cell (293T), murine DLBCL cell (A20), and human DLBCL cells (OCI-LY7, DB, U2932, and FARAGE) were purchased from American Type Culture Collection (ATCC; Manassas, VA, USA). GM12878 cells were grown in RPMI 1640 (HyClone, Logan, UT, USA) with GlutaMAX Supplement (Thermo Fisher Scientific, Waltham, MA, USA), 15% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA), and 1% pen/strep (Invitrogen, Carlsbad, CA, USA). DLBCL cells were grown in RPMI 1640 with 10% FBS and 0.05 mg/mL gentamycin (Schering-Plough Europe, Brussels, Belgium). 293T cells were grown in DMEM (Thermo Fisher Scientific) containing 10% FBS and 1% pen/strep. Cells were cultured at 37 °C in 5% CO2.
+ Open protocol
+ Expand
9

Culturing Human Lymphoma Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human lymphoma cell lines (Mino, Maver-1, Jeko-1, Z-138, OCI-Ly7, OCI-Ly10, SU-DHL-6, SU-DHL-8, U2932, Daudi, Namalwa, Raji, and Ramos) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and DSMZ (Braunschweig, Germany). Cells were cultured in RPMI1640 medium containing 10% foetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin (Invitrogen, Carlsbad, CA, USA) at 37 °C in an atmosphere of 5% CO2. OCI-Ly7 and OCI-Ly10 were cultured in IMDM. Tests for mycoplasma contamination were negative. Ibrutinib and venetocalx were purchased from Selleck Chemicals (Houston, TX, USA).
+ Open protocol
+ Expand
10

Cell Culture Protocols for Various Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human lymphoblastoid B cell (GM12878), human renal epithelial cells (293 T) and DLBCL cells (OCI-LY7, DB, U2932, and FARAGE) were purchased from American Type Culture Collection (ATCC, USA). The 293 T cells were maintained in DMEM with 10%(v/v) FBS. The GM12878 cells were cultured in Roswell Park Memorial Institute 1640 medium (RPMI 1640; Gibco) supplemented with 15% fetal bovine serum (FBS; Gibco) and 1% penicillin–streptomycin (Gibco) at 37℃ with 5% CO2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!