7500 qpcr machine

The cDNAs of MLs, IILs, AWs, and NBLs were prepared according to previous references [9 (link), 46 (link)]. Specific primers were designed by Primer 5 (5′-TACGGAAAAACGTATGCAAATG-3′; 5′-CAAATTCTCCATGAGTCAAATCGG-3′). GAPDH (GenBank: AF452239) was selected as the internal reference gene, as previously reported [23 (link), 42 (link)]. The specific primers for GAPDH were as follows: 5′-AG ATGCTCCTATG TTGGTTATGGG-3′; 5′-GTCTTTTGGGTTGCCGTTGTAG-3′. qPCR was performed using SYBR Green qPCR Master Mix (TargetMol, China) on an Applied Biosystems 7500 qPCR machine. Subsequently, the relative transcript levels of TsCatL were analysed using the comparative Ct (2^−ΔΔCt) method [46 (link)].

The total RNA in each sample was separated by using a mirVana kit (Ambion, Hercules, CA). The quality and concentration of separated total RNA samples was evaluated by NanoDrop ND‐3000. The isolated total RNA, including circRNAs and miRNAs, in each sample was subject to reverse transcription done by utilizing a miRCURY qPCR assay kit (Exiqon, Vedbaek, Denmark) to generate corresponding cDNA templates. Then, to determine the relative expression of circRNA‐0068481 (Forward: 5’‐TATCTGCCCAAGGAGAGCAT‐3’; Reverse 5’‐TATTATCCATGGGAGGGAAGGT‐3’), miR‐646 (Forward: 5’‐AGCAGCTGCCTCTGAG‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’), miR‐570 (Forward: 5’‐ GAAAACAGCAATTACCTTTG‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’), miR‐885 (Forward: 5’‐ CCATTACACTACCCTGC‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’) and EYA3 mRNA (Forward: 5’‐ GCAGTAGCCAGCATCTCAAACC‐3’; Reverse: 5’‐ GTCTGACCTGTGACTCCAAAGC‐3’) in each sample, qPCR was done with SYBR Green master mix in conjunction with specific primers and probes designed by Exiqon (Vedbaek, Denmark) on a 7500 qPCR machine (Applied Biosystems, Foster City, CA) to determine the relative expression of circRNA‐0068481, miR‐646, miR‐570, miR‐885 and EYA3 mRNA by utilizing the 2^‐ΔΔCT approach.²⁵

Total RNAs from tissue samples or cell pellets were isolated by using the TRIzol Reagent (Invitrogen). The cDNAs were reversely transcribed from 2 μg of total RNAs using TaqMan Reverse Transcription Reagents (Applied Biosystems). Expression levels of mRNAs were determined by quantitative real-time PCR (qPCR) using Applied Biosystems 7500 qPCR machine. Reactions were done in triplicate for each sample using SYBR Green Real-Time PCR Master Mix (Invitrogen). The relative expression level of each mRNA was calculated by the 2(^−DDCt) method. GAPDH was used as an internal invariant control. All qPCR primer sequences are available upon request.

Total RNA was extracted from cells using TRIzol reagent (#15596-026, Ambion), DNase treated using the RNase free DNase kit (#79254, Qiagen) and re-purified with the RNeasy Mini kit (#74204, Qiagen). The cDNA was generated with High-Capacity cDNA Reverse Transcription Kit (#4368814, Applied Biosystems). All procedures were performed according to manufacturer’s instructions. Primers were designed for each target gene using NCBI Primer BLAST (Sup. Table 5), and qRT-PCR was performed with SYBR-Green mix (#4438, Sigma-Aldrich) using an Applied Biosystems 7500 qPCR machine (annealing at 60 °C). The qRT-PCR reactions were performed using 5 ng cDNA per 20 µl reaction, in triplicates and relative gene expression was calculated with the D-ΔΔCt method^{46 (link)}, using the geometric mean of β-Actin and human ribosomal protein lateral stalk subunit P0 (RPLP0) expression to normalise gene expression of target genes. Standard curves were made for each primer pair and the efficiency calculated using the formula E = 10[−1/slope].