7.2 mg NaH (dry, 90%, Merck), 132 mg triphenyl bismuth (99%, Alfa Aesar) and 32 mg sulphur powder (99.5%, Alfa Aesar) were dissolved in 10 mL degassed oleylamine (70%, Merck) under stirring at room temperature for 15 min. The solution was heated at 80 or 150 °C for 30 min after which the solution colour turned from red to black. All the above processes were performed in a glovebox. Later, the whole solution was cooled down to room temperature in a water bath, and mixed with 6 mL hexane (>95%, Merck) and 14 mL oleic acid (90%, Merck) for at least 2 h to replace most oleylamine ligands by strongly attached oleic acid ligands. Finally, acetone (anhydrous, >99.9%, ROMIL) and acetonitrile (anhydrous, >99.9%, ROMIL) was used to precipitate the synthesized NaBiS2 NCs, and the purified NCs were re-dissolved in hexane.
Oleylamine
Manufactured by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, China, India, Cameroon, Singapore, Belgium, Italy, Spain
Oleylamine is a chemical compound used as a surfactant, emulsifier, and lubricant in various industrial applications. It is a long-chain aliphatic amine with a hydrocarbon backbone and an amino group at one end. Oleylamine is commonly used in the formulation of lubricants, coatings, and personal care products.
Automatically generated - may contain errors
Lab products found in correlation
Oleic acid, by Merck Group (278 mentions)
1 octadecene, by Merck Group (160 mentions)
Toluene, by Merck Group (84 mentions)
Hexane, by Merck Group (54 mentions)
Ethanol, by Merck Group (46 mentions)
Cesium carbonate, by Merck Group (44 mentions)
Octadecene, by Merck Group (43 mentions)
1 2 hexadecanediol, by Merck Group (38 mentions)
1 dodecanethiol, by Merck Group (35 mentions)
Chloroform, by Merck Group (35 mentions)
Trioctylphosphine, by Merck Group (33 mentions)
Iron 3 acetylacetonate, by Merck Group (31 mentions)
Benzyl ether, by Merck Group (31 mentions)
Lead bromide, by Merck Group (30 mentions)
Sulfur powder, by Merck Group (28 mentions)
Acetone, by Merck Group (27 mentions)
Methanol, by Merck Group (26 mentions)
Cadmium oxide, by Merck Group (24 mentions)
Trioctylphosphine oxide, by Merck Group (22 mentions)
Selenium powder, by Merck Group (20 mentions)
503 protocols using oleylamine
1
Synthesis of NaBiS2 Nanocrystals
2
Synthesis of Colloidal Semiconductor Nanocrystals
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Selenium powder (Sigma-Aldrich, 99.99%), selenium disulfide (SeS2, Sigma-Aldrich), mercury acetate (Hg(OAc)2, Sigma-Aldrich), trioctylphosphine (TOP, Cytek, 90%), dodecanethiol (DDT, Sigma-Aldrich), oleic acid (Sigma-Aldrich, 90%), oleylamine (Acros, 80-90%), arsenic trisulfide (As2S3 ,Strem, 99.9%), propylamine (Sigma-Aldrich, 98%), n-methylformamide (NMFA, VWR, 98%), lithium perchlorate (LiClO4, Sigma-Aldrich, 98%), polyethylene glycol 6k (PEG 6k, MW=6kg.mol -1 , Fluka), ethanol absolute anhydrous (99.9%, Carlo Erba) acetone (Carlo-Erba, 99.8%), ammonium iodide (NH4I, Sigma-Aldrich, 99%), ammonium thiocyanate (NH4SCN, Sigma-Aldrich, 99%), 1,2-ethanedithiol (EDT, Fluka, 98.0%), sodium sulfide nonahydrate (Na2S,9H2O, Sigma-Aldrich 98.0%).
All chemicals are used as received, except oleylamine which is centrifuged before use. Precursors 1.54 g of Se powder is mixed in 20 mL of TOP. After sonication, a transparent solution is obtained.
All chemicals are used as received, except oleylamine which is centrifuged before use. Precursors 1.54 g of Se powder is mixed in 20 mL of TOP. After sonication, a transparent solution is obtained.
3
Synthesis of Selenium Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Se powder (Sigma-Aldrich, 99,99%), mercury acetate (Hg(OAc)2, Sigma-Aldrich), Trioctylphosphine (TOP, Cytek, 90%), dodecanthiol (DDT, Sigma Aldrich), oleic acid (Sigma-Aldrich, 90%), oleylamine (Acros, 80-90%), LiClO4 (Aldrich 98%), Polyethylene glycol (M W =6kg.mol -1 ), N-methylformamide (NMFA, VWR, 98%), Na2S (Aldrich) All chemical are used as received, except oleylamine which is centrifuged before used.
4
Synthesis of Oleylamine-Capped ZnO Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals and reagents for ZnO@OAm NPs synthesis were of analytical grade and were used without any further purification: Zinc (II) acetylacetonate hydrate [Sigma-Aldrich, St. Louis, MO, USA, M = 263.61 g mol−1, Zn(acac)2], Oleylamine [Merck, Darmstadt, Germany, M = 267.493 g mol−1, OAm], and ethyl alcohol (M = 46.07 g mol−1).
5
Synthesis of Inorganic Nanomaterials
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were used as purchased without further purification. Chromium potassium sulfate dodecahydrate, sodium chloride (99%), potassium hydrogen carbonate (99.7%), potassium ferrocyanide (99%), bismuth powder (99.5%, 100 mesh), copper powder (99.5%, 100 mesh), tin powder (99.5%, 100 mesh), acetone (99%), and 1-octadecene (90% technical grade) were purchased from Thermo Fisher Scientific (Alfa Aesar, Acros Organics). 1,3-Propanediamine-N,N,N′,N′-tetraacetic acid (99%), 1-octanethiol (98.5%), oleylamine (70% technical grade), bismuth neodecanoate, bismuth nitrate pentahydrate (99.99%), ethylene glycol (99%), and molybdenum carbide were purchased from Merck (Sigma Aldrich). Isopropanol (99.5%) was purchased from Honeywell. Potassium hydroxide (reagent grade) was purchased from VWR. Gold mesh (99.9%, 0.06 mm diameter, 20 × 20 mm area, 82 wires per inch) and bismuth foil (99.999%, 0.25 × 10 × 10 mm) were purchased from Goodfellow Cambridge Ltd.
6
Synthesis of Colloidal Metallic Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All analytical-grade chemicals,
including chloroplatinic acid (H2PtCl6·H2O), poly(vinylpyrrolidone) (PVP; MW = 40000), cobalt nitrate
hexahydrate [Co(NO3)2·6H2O],
oleylamine (C18H37N), tetraethylorthosilicate
(TEOS; SiC8H20O4), ethylene glycol
(C2H6O2), ethanol (C2H6O), mesitylene (C9H12), hydrochloric
acid (HCl), hexane (C6H12), ammonium fluoride
(NH4F), and acetone (C3H6O) were
purchased from Merck Hungary Ltd. and were used without further purification.
For inductively coupled plasma mass spectrometry (ICP-MS) measurements,
concentrated HNO3 and HCl were used (Aristar for trace
metal analysis, VWR Chemicals). Ultrahigh-purity (5.0 quality) gas
cylinders of argon, oxygen, nitrogen, hydrogen, and the gas mixture
CO2:H2 = 1:4 were purchased from Messer Hungarogáz
Ltd.
including chloroplatinic acid (H2PtCl6·H2O), poly(vinylpyrrolidone) (PVP; MW = 40000), cobalt nitrate
hexahydrate [Co(NO3)2·6H2O],
oleylamine (C18H37N), tetraethylorthosilicate
(TEOS; SiC8H20O4), ethylene glycol
(C2H6O2), ethanol (C2H6O), mesitylene (C9H12), hydrochloric
acid (HCl), hexane (C6H12), ammonium fluoride
(NH4F), and acetone (C3H6O) were
purchased from Merck Hungary Ltd. and were used without further purification.
For inductively coupled plasma mass spectrometry (ICP-MS) measurements,
concentrated HNO3 and HCl were used (Aristar for trace
metal analysis, VWR Chemicals). Ultrahigh-purity (5.0 quality) gas
cylinders of argon, oxygen, nitrogen, hydrogen, and the gas mixture
CO2:H2 = 1:4 were purchased from Messer Hungarogáz
Ltd.
7
Synthesis of Luminescent Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ferric hydroxide oxide (hydrated, 30–50 mesh), oleic acid (90%), oleylamine (90%), n-docosane (99%), ammonia (30%), tetraethylorthosilicate (TEOS, 99%), (3-chloropropyl)-triethoxysilane (95%), (3-iodopropyl)trimethoxysilane (95%), sodium iodide, potassium tertbutoxide (tBuOK), tert-butanol (tBuOH), europium(III) chloride hexahydrate (99.9%, trace metals basis), terbium(III) chloride hexahydrate (99.9%, trace metals basis), acetylacetone, pentane, diethyl ether, cyclohexane, acetone, and ethanol were purchased from Merck. Triton X-100 and 1-hexanol (99%) were purchased from Alfa Aesar (Haverhill, MA, USA).
8
Synthesis of Inorganic Precursors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indium(III) acetylacetonate (In(acac)3, ≥99.99% metal basis), tin(IV) tert-butoxide (Sn(OtBu)4, ≥99.99% metal basis), benzylamine (BnNH2, for GC derivatization, ≥99%), tin(IV) bis(acetylacetonate)dichloride (98%), benzyl alcohol (BnOH, anhydrous, 99.8%), m-xylylenediamine (m-XDA, ≥99%), oleylamine (OAm, technical grade, 70%), 2-[2-(2-methoxyethoxy)ethoxy]acetic acid (MEEAA, technical grade), tetrahydrofuran (≥99.9%), sodium chloride (>99% ACS reagent), potassium chloride (>99.99% trace metals basis) and sodium sulfate (≥99.99% trace metals basis) were purchased from Merck KGaA (Darmstadt, Germany), and acetone (absolute) was purchased from Fisher Scientific (Waltham, MA, USA). All chemicals were used without further purification. Liquid carbon dioxide (CO2) and nitrogen (N2) were provided by PanGas AG (Dagmersellen, Switzerland).
9
Synthesis of Quantum Dot Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silver(I) chloride (AgCl), selenium powder (Se), mercaptopropionic acid (MPA), zinc(II) chloride (ZnCl2), gallium(III) chloride (GaCl3), sulfur powder (S), 1-dodecanethiol (DDTh), ʟ-cysteine, copper(II) chloride, polyvinylidene fluoride (PVDF), titanium isisopropoxide (TIP), glycerol, oleylamine (OAM), titanium tetrachloride (TiCl4), N-methyl-2-pyrrolidine (NMP), chloroform, acetonitrile, ethanol, and methanol were purchased from Merck India.
10
Synthesis of Colloidal Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oleylamine, colbalt chloride hexahydrate, trioctylyphosphine oxide (TOPO), trioctylyphosphine (TOP), hexadecylamine (HDA), silver nitrate (AgNO 3), oleic acid, octadecene, selenium (Se), sulphur, Trizma® acetate, N,N-diisopropylethylamine, poly(isobutylene-alt-maleic anhydride) and As (III) oxide were purchased from Merck. Citric acid and CTAB were purchased from Acros Organics. Myristic acid, n-octylamine, MES, indium chloride hydrate (InCl 3.H2O), potassium phosphate monobasic (KHPO 4), potassium phosphate dibasic (KH2PO4), zinc acetate dihydrate (ZnAc.2H2O), mercury (II) chloride, iron (II) chloride hexahydrate (FeCl 3.6H2O), gold (III) chloride trihydrate (HAuCl 4.3H2O), calcium chloride, silver nitrate (AgNO3), and copper (II) chloride dihydrate were purchased from Thermo Fisher. All other chemicals were used as received. Anti As (III)-Apt with the sequence: GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGC TCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT [33], was synthesized and purified by Merck.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!