Total RNAs from different development stages of P. litchii, including mycelia and zoospores, and samples from 3, 6, 12, and 24 h post-inoculation with zoospores on leaves, were extracted using the All-In-One DNA/RNA Mini-preps Kit (Bio Basic, Shanghai, China). Reverse transcription was performed using SYBR® Premix Ex TaqTM II (TaKaRa, Japan). Expression profiles of PlPeL1 and PlPeL1-like genes were detected using quantitative reverse-transcription polymerase chain reaction (qRT-PCR) on qTOWER3 Real-Time PCR thermal cyclers (Analytik Jena, Germany) with SYBR® Premix Ex TaqTM II (TaKaRa, Japan). The P. litchii actin gene (PlActin)69 (link) was used as an endogenous control, and the relative fold change was calculated using the 2−ΔΔCT method. Primers used for these analyses were listed in Supplementary Data 4 .
Sybr premix ex taqtm 2
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany, Australia, Switzerland
SYBR Premix Ex TaqTM II is a ready-to-use solution for real-time PCR applications. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and buffer components optimized for efficient amplification and detection of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (209 mentions)
Primescript rt reagent kit, by Takara Bio (186 mentions)
Trizol, by Thermo Fisher Scientific (76 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (73 mentions)
Rnaiso plus, by Takara Bio (68 mentions)
Primescript rt master mix, by Takara Bio (52 mentions)
Trizol reagent, by Takara Bio (33 mentions)
Rnaiso plus reagent, by Takara Bio (26 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (24 mentions)
Rneasy mini kit, by Qiagen (20 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (19 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (18 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (18 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (18 mentions)
Lightcycler 480, by Roche (17 mentions)
Cfx96 real time system, by Bio-Rad (17 mentions)
Primescript rt kit, by Takara Bio (16 mentions)
Primescript reverse transcriptase, by Takara Bio (14 mentions)
Primescript rt master mix kit, by Takara Bio (14 mentions)
Prim script rt reagent kit, by Takara Bio (12 mentions)
917 protocols using sybr premix ex taqtm 2
1
Quantifying P. litchii Gene Expression
2
Quantitative Analysis of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using RNAiso Plus (TaKaRa, Japan), total RNA was extracted from bone tissue or cells. For the quantification of miRNA, a Mir-X miRNA First-Strand Synthesis Kit (TaKaRa, Japan) was used to prepare the cDNA. SYBR® Premix Ex TaqTM II (TaKaRa, Japan) was used to quantitatively detect target gene expression. U6 small nuclear RNA was used as a loading control. For the quantification of mRNA, cDNA was synthesized using a PrimeScript® RT Master Mix reagent kit (TaKaRa, Japan). The subsequent real-time PCR detection was conducted using SYBR® Premix Ex TaqTM II (TaKaRa, Japan) and a CFX96 real-time PCR detection system (BIO-RAD, USA). GAPDH was used as a reference gene. The primers used for real-time PCR are listed in Supplementary Table 1 .
3
Sensitive SYBR Green RT-PCR for CCYV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The real-time RT-PCR assays were performed using SYBR Premix Ex TaqTM II (Takara). All reactions were carried out in a final volume of 20 μl each containing: 10 μl of SYBR Premix Ex TaqTM II (Takara), 1 μl of cDNA or plasmid dilutions and 0.8 μl of each primer (CCYV-F and CCYV-R). Amplification reactions were performed as follows: 94 °C for 2 min; 40 cycles of 94 °C for 15 s, 60 °C for 20 s, 72 °C for 20 s.
For generation of standard quantification curves, serial 10-fold dilutions of plasmid (3.79 × 102 to 3.79 × 108 copies/μl) were used as templates for real-time RT-PCR. Standard curves were obtained by linear regression analysis of the threshold cycle (Ct) value of each of three replicates over the logarithm of the copy numbers present in each sample. To determine the sensitivity and the reliability of the real-time RT-PCR, three individual assays were undertaken using the 10-fold serial dilutions of plasmid.
For generation of standard quantification curves, serial 10-fold dilutions of plasmid (3.79 × 102 to 3.79 × 108 copies/μl) were used as templates for real-time RT-PCR. Standard curves were obtained by linear regression analysis of the threshold cycle (Ct) value of each of three replicates over the logarithm of the copy numbers present in each sample. To determine the sensitivity and the reliability of the real-time RT-PCR, three individual assays were undertaken using the 10-fold serial dilutions of plasmid.
4
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Given that the eyes of T. rosa eyes are very small, to facilitate RNA extraction, tissues from three individual specimens were pooled to form a single sample, whereas only single-individual samples were necessary for T. bleekeri. RNA was extracted from three biological replicates (per species) using an RNeasy® plus universal mini kit (QIAGEN, Leipzig, German). Complementary DNA was synthesized using a PrimeScriptTM reverse transcription (RT) reagent kit with gDNA eraser (TaKaRa, Peking, China). Real-time PCR was conducted using SYBR® Premix Ex TaqTM II (TaKaRa, Peking, China). The Tu translation elongation factor, mitochondrial (tufm) was used an internal control. Primers were designed based on the relevant genes in both species, derived using AlleleID 6 (Apte and Singh, 2007 (link)) from our transcriptome, with synthesis being performed by Invitrogen (see Table S1
5
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. For mRNA, cDNA was synthesized using the PrimeScript® RT Master Mix reagent kit (TaKaRa, Japan). Then, SYBR® Premix Ex TaqTM II (TaKaRa) was used to prepare qRT‐PCR on a BIO‐RAD CFX96 instrument. For miRNA, a Mir‐X miRNA First‐Strand Synthesis Kit (TaKaRa) was used to prepare the cDNA. And qRT‐PCR was then performed using SYBR® Premix Ex TaqTM II (TaKaRa). GAPDH or U6 was used for normalization. The primers are detailed in Table S1 .
6
Quantifying SPP1 mRNA Expression in GAC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from GAC tissues and pericarcinomatous tissue was extracted by TRIzol solution (Invitrogen, CA, USA). To synthesized cDNA, PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, Dalian, China) was applied. The QPCR was carried out by the SYBR Premix ExTaq TM II (Takara, Dalian, China) by ABI 7900 qRT-PCR system (Applied Biosystems, Foster City, CA, United States). The cDNA was then subjected to qRT-qPCR by SYBR Premix ExTaq TM II (Takara, Dalian, China) to evaluate the relative mRNA levels of SPP1 on an Applied Biosystems real-time PCR machine (ABI 7900HT, CA, USA), and β-actin was applied as the internal control. And, the relative mRNA level was calculated by utilizing the 2−ΔΔCt method.
Primer sequence:
Primer sequence:
SPP1 F: 5′-TTTGTTGTAAAGCTGCTTTTCCTC-3′
R: 5′-GAATTGCAGTGATTTGCTTTTGC-3′
β-Actin F: 5′-CTCTCTCTACCTACATCTCTACTAAAA-3′
R: 5′-AACTCTAACTCTCTCTCTAACTACTTCTC-3′
7
Exosomal miRNA and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and puri ed using the BioFlux RNA Extraction Kit (BioFlux Company, Tokyo, Japan). For exosomal microRNA (miR-103a, let-7d, miR-411, miR-345, miR-328-3P) expression analysis, 0.5 mg of total RNA was rst reverse-transcribed with the PrimeScript® 1st Strand cDNA Synthesis Kit (BioFlux Company, Tokyo, Japan) according to the standard protocol. qPCR was performed using SYBR®Premix Ex TaqTM II (TaKaRa, Dalian, China) based on the manufacturer's instructions. The primer sequences are shown in Table 1. For mRNA expression analysis, complementary DNA (cDNA) was synthesized using the PrimeScript® 1st Strand cDNA Synthesis Kit (BioFlux Company, Tokyo, Japan) according to the manufacturer's protocol. Brie y, 2.0 µL of the cDNA template was added to a total volume of 20.0 µL containing 10.0 µL of SYBR®Premix Ex TaqTM II (TaKaRa, Dalian, China), 0.4 µL of Rox 6.0 µL of ddH 2 O, and 0.8 µL of the forward and reversed primers. The thermal cycling conditions were as follows: (1) pre-denaturation (30 s at 95 ℃); (2) ampli cation and quanti cation (40 cycles of 30 s at 94 ℃, 30 s at 60 ℃). The relative expression was given as the ratio of expression of the target gene to the housekeeping gene using the formula 2 -△△t . Relative expression was normalized and given as a ratio to the expression in the control group.
8
Quantifying Gene Expression in PBMC Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from infected PBMCs using the miRNeasy Mini Kit (Qiagen), and RNA was transcribed using PrimpScript RT-PCR Kit (TAKARA) according to the manufacturer’s instructions. qPCR was performed using 2 x SYBR Premix Ex TaqTM II (TAKARA). The ABI Prism 7900HT (Applied Biosystems) was used for qPCR reactions, and GAPDH was used as the internal reference (52 (link)). Fold changes in gene expression were calculated using the 2-ΔΔCt method.
9
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using the miRNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Nuclear RNA and cytoplasmic RNA were extracted following the instructional manuals of the nuclear and cytoplasmic extraction reagents kit (Beyotime, Beijing, China). cDNA was synthesized from miRNA and mRNA using the Mir-XTM miRNA First-Strand Synthesis Kit (Takara Bio Inc., Shiga, Japan) and a PrimeScriptTM RT Master Mix (Takara Bio Inc., Shiga, Japan), respectively. PCR reaction was conducted in 20 μl total volume containing a final concentration of 0.5 mM of each primer, 6.4 μl ddH2O, 10 μl of 2x SYBR Premix Ex TaqTM II (Takara Bio Inc., Shiga, Japan) and 2 μl of cDNA sample (1:20 diluted) corresponding to 1 μg of total RNA. RT-qPCR reaction was performed on an ABI ViiATM 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). The amplification products were detected by agarose gel electrophoresis and sequencing. Transcript levels of lncRNA and mRNA were normalized to that of the GAPDH housekeeping gene, and those of miRNA were normalized to that of the small U6 RNA. The RT-qPCR primer sequences are listed in Supplementary Table 1 . Expression levels were calculated using the 2–ΔΔCt method (Livak and Schmittgen, 2001 (link)). Each experiment was performed in triplicate.
10
Quantitative Analysis of Bim Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from DMAMCL-treated RMS cell and tumor tissues by using Trizol reagent according to the manufacturer’s instructions. cDNA was prepared with RNA by using GoScriptTM Reverse Transcription System kit. Quantitative PCR was performed with the cDNA by using SYBR Premix Ex TaqTM II (TaKaRa Clontech) according to the manufacturer’s instructions. Beta-actin expression served as an internal control. Relative quantification of gene expression was performed with the 2(− ΔΔCt) method. Details of the PCR primers sequences were as follows: Bim sense 5′- CCCCTACCTCCCTACAGACAGA-3′, Bim anti-sense 5′- TCCAATACGCCGCAACTCTT-3′; β-actin sense 5′- AACTGGGACGACATGGAGAAA -3′, β-actin anti-sense 5′- AGGGATAGCACAGCCTGGATA -3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!