Transit 2020 reagent

Manufactured by Mirus Bio

Sourced in United States

The TransIT-2020 reagent is a transfection reagent designed for efficient delivery of nucleic acids, such as plasmid DNA, into a variety of cell types. The core function of this product is to facilitate the uptake and expression of the delivered genetic material within the target cells.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase reporter assay system, by Promega (9 mentions) Passive lysis buffer (plb), by Promega (8 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (5 mentions) Pmd2 g, by Addgene (4 mentions) Prl tk, by Promega (4 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) Pspax2, by Addgene (3 mentions) Varioscan, by Thermo Fisher Scientific (3 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Lipofectamine plus, by Thermo Fisher Scientific (2 mentions) Hek293 cell, by American Type Culture Collection (2 mentions) Pgl4luc rluc dual luciferase plasmid, by Addgene (2 mentions) Selection for hygromycin resistance, by Thermo Fisher Scientific (2 mentions) Megascript t7 transcription kit, by Thermo Fisher Scientific (2 mentions) Dotap liposomal transfection reagent, by Roche (2 mentions) Dotap reagent, by Roche (2 mentions) Schneider s insect medium, by Merck Group (2 mentions) Luciferase assay kit, by Promega (2 mentions) Glomax multi detection system, by Promega (2 mentions)

53 protocols using transit 2020 reagent

siRNA and DNA Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

For siRNA transfection, MCF10A, HEK293T, HeLa and HepG2 cells were plated in six-well plates and cells were transfected with 100 nM siRNA using Lipofectamine RNAiMAX (13778150 Invitrogen) for 6 h per well. The following day, cells were re-transfected with 50 nM siRNA. When required, cells were split in the 6- or 12-well plates.
For DNA transfection, MCF10A cells were seeded in six-well plates and cells were transfected with 1 µg of DNA constructs (CTNNA1 wild type or mutants) using TransIT-2020 reagent (Mirus). HepG2 cells were cultured in six-well plate and transfected with wild-type CTNNA1 (1 µg) by using TransIT-2020 reagent (Mirus). After 24 h, cells were re-transfected with 1 µg of cDNA in order to increase the transfection efficiency. HeLa and MCF7 cells were seeded in six-well plates and cells were co-transfected with 1 µg of both mRFP-LC3 and mEm-CTNNA1 using TransIT-2020 reagent (Mirus). On the following day, cells were reseeded in the 6- or 12-well plates according to the experimental requirements.

Pavel M., Park S.J., Frake R.A., Son S.M., Manni M.M., Bento C.F., Renna M., Ricketts T., Menzies F.M., Tanasa R, & Rubinsztein D.C. (2021). α-Catenin levels determine direction of YAP/TAZ response to autophagy perturbation. Nature Communications, 12, 1703.

+ Open protocol

+ Expand

CRISPR-Cas9 Mediated p300 Knockout

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

p300 KO HeLa and SH-SY5Y cells were generated with the CRISPR–Cas9 technology. Cells were transiently cotransfected using Trans IT-2020 reagent (catalogue no. MIR5400; Mirus) according to the manufacturer’s instructions. The Lenti-PB (pKLV–PB–U6gRNA(BbsI)–PGKpuro2ABFP) vector carrying two guide RNAs (gRNAs) was mixed with the LentiCas9blast vector in a molar ratio 1:3 (all constructs kind gifts from E. Metzakopian, UK Dementia Research Institute^{67 (link)}). Transfected cells were treated with 3 μg ml⁻¹ puromycin (catalogue no. A11138-03; Gibco) to select for gRNA-expressing cells and then single sorted. Clones were selected based on p300 levels, compared with non-targeting gRNA-transfected cells.
Two gRNA sequence against p300 are below:
gRNA #1: sense 5′-CACCGTAGAGTTGATTAATTCATCGT-3′
antisense 5′-TAAAACGATGAATTAATCAACTCTAC-3′
gRNA #2: sense 5′-CACCGTGATTAATATCACCACCATGT-3′
antisense 5′-TAAAACATGGTGGTGATATTAATCAC-3′

Son S.M., Park S.J., Breusegem S.Y., Larrieu D, & Rubinsztein D.C. (2024). p300 nucleocytoplasmic shuttling underlies mTORC1 hyperactivation in Hutchinson–Gilford progeria syndrome. Nature Cell Biology, 26(2), 235-249.

+ Open protocol

+ Expand

Cell Culture and Stimulation Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells (ATCC, Manassas, VA) were cultured as described^{34 (link)}. Mouse embryo fibroblasts were prepared from E13 embryos using standard protocols. Mouse astrocytes were kindly provided by Dr. Pamela Knapp (VCU, Richmond, VA). Human cortical astrocytes were prepared from fetal tissue provided by Advanced Bioscience Resources, Inc. (Alameda, CA) and cultured as previously described^{47 (link)}. Cells were stimulated with 10 ng/ml IL-1 for 2h, unless indicated otherwise. Cells were transfected with expression plasmids using either Lipofectamine Plus (Invitrogen) or TransIT2020 reagent (Mirus, Madison, WI).

Harikumar K.B., Yester J.W., Surace M.J., Oyeniran C., Price M.M., Huang W.C., Hait N.C., Allegood J.C., Yamada A., Kong X., Lazear H.M., Bhardwaj R., Takabe K., Diamond M.S., Luo C., Milstien S., Spiegel S, & Kordula T. (2014). K63-linked polyubiquitylation of IRF1 transcription factor is essential for IL-1-induced CCL5 and CXCL10 chemokine production. Nature immunology, 15(3), 231-238.

+ Open protocol

+ Expand

Ccl2 gene promoter cloning and luciferase assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 2.7kb fragment containing the conserved non-coding sequence (CNS) and promoter of Ccl2 gene were amplified from mouse genomic DNA using the following primers. 5’-GCTAGCCTCGAGTGATGTTCTATCAGTCCTCACCCCATTAC-3’, 5’- GAGGCCAGATCTCTCTGAGGCAGCCTTTTATTGTTAGCCAG-3’. The amplified fragment was digested with restriction enzymes XhoI and BglII and cloned into pGL4Luc-Rluc dual luciferase plasmid (Addgene, plasmid #64034).
MLE-12 cells, control cells or NMP4 knockdown cells, were culture in 24-well plate until 80% confluency and then transfected with pGL4Luc-Rluc vector or reporter plasmid using TransIT-2020 reagent (Mirus). After 24 hours of incubation in transfection complex, cells were stimulated with poly (I:C) (5μg/mL) for 6 hours and cell extracts were obtained through passive lysis buffer. Luciferase activities were measured using dual luciferase reporter assay system (Promega) according to the manufacturer’s instructions. Firefly values were then normalized to Renilla values.

Yang S., Adaway M., Du J., Huang S., Sun J., Bidwell J.P, & Zhou B. (2020). NMP4 regulates the innate immune response to influenza A virus infection. Mucosal immunology, 14(1), 209-218.

+ Open protocol

+ Expand

Knocking Down Akt1 in Mouse Lung

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knock down mouse Akt1 protein in vivo in lung, we generated the VSVG pseudotyped lentiviruses (109–1010 TU/ml) expressing mouse Akt1 shRNA and non-silencing shRNA as control (provided by DNA/RNA Delivery Core, Skin Biology and Diseases Resource-based Center, Northwestern University, Chicago, IL, USA). For lentivirus packaging, 293T packaging cells (Gene Hunter Corporation) were transiently transfected using Transit-2020 reagent (Mirus) with the following vectors: second generation packaging vectors psPAX2 and pMD2.G (Addgene) and third generation lentiviral expression vector pLKO (Sigma). The pLKO vectors either encoded two specific shRNAs against mouse Akt1 (Cat# TRCN0000304683) or a non-silencing control shRNA sequence (Cat# SHC002) (all from Sigma). Akt1 shRNA and control non-silencing shRNA viruses were intratracheally instilled in mice in a volume of 50 μl. Mice were exposed to 10% CO₂, or air as control, and infected with IAV 2 weeks after lentivirus instillation. Akt1 silencing was confirmed by western blot and IF analysis, as described above.

Casalino-Matsuda S.M., Chen F., Gonzalez-Gonzalez F.J., Nair A., Dib S., Yemelyanov A., Gates K.L., Budinger G.R., Beitel G.J, & Sporn P.H. (2020). Hypercapnia Suppresses Macrophage Antiviral Activity and Increases Mortality of Influenza A Infection via Akt1. Journal of immunology (Baltimore, Md. : 1950), 205(2), 489-501.

+ Open protocol

+ Expand

Plasmid Transfection Using TransIT-2020

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid DNAs were transfected by TransIT-2020 reagent (Mirus Bio) as recommended by the manufacturer's instruction.

Kim S., Jin B., Choi S.H., Han K.H, & Ahn S.H. (2014). Casein Kinase II Inhibitor Enhances Production of Infectious Genotype 1a Hepatitis C Virus (H77S). PLoS ONE, 9(12), e113938.

+ Open protocol

+ Expand

In vivo FXYD5 Knockdown in Mouse Lung

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knock down mouse FXYD5 protein in vivo in lung, we generated the VSVG pseudotyped lentiviruses (10⁹–10¹⁰ TU/ml) expressing mouse FXYD5 shRNA and non-silencing shRNA as control (47 (link), 48 (link)) (provided by DNA/RNA Delivery Core, SDRC, Northwestern University, Chicago, IL, USA). For lentivirus packaging, 293T packaging cells (Gene Hunter Corporation) were transiently transfected using Transit-2020 reagent (Mirus) with the following vectors: second generation packaging vectors psPAX2 and pMD2.G (Addgene) and third generation lentiviral expression vector pLKO (Sigma). The pLKO vectors used encoded two specific shRNAs against mouse FXYD5 (Cat# TRCN0000079348, sense: CCTCCAAACTACACCAACTCA; and Cat# TRCN0000079352, sense: GTGCTGTTCATCACGGGAATT), and a non-silencing control shRNA (Cat# SHC002) (all from Sigma). FXYD5 shRNA and control non-silencing shRNA viruses were intratracheally instilled in mice in a volume of 50 µl. FXYD5 silencing was confirmed by RT-qPCR and Western blot analysis as described above.

Brazee P.L., Soni P.N., Tokhtaeva E., Magnani N., Yemelyanov A., Perlman H.R., Ridge K.M., Sznajder J.I., Vagin O, & Dada L.A. (2017). FXYD5 Is an Essential Mediator of the Inflammatory Response during Lung Injury. Frontiers in Immunology, 8, 623.

+ Open protocol

+ Expand

Transfection, RNAi, and Irradiation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stable lines were generated by co-transfection of expression constructs with pCoHygro (Life Technologies) using the DOTAP Liposomal Transfection Reagent (Roche) and selection for hygromycin resistance at 100 ug/mL (Life Technologies). Transient transfections were conducted using the TransIT-2020 reagent (Mirus), and live imaging was performed 72 hours later. RNAi was performed with dsRNA generated from MEGAScript T7 Transcription kit (Life Technologies) and PCR products containing T7 promoter sequences and the target regions (Table S2). Tissue culture cells were treated with 5–10 ug of dsRNA for 5 days with DOTAP Reagent (Roche). Irradiation experiments were conducted by exposing cells to 5 Gy of X-rays from a 130 kv Faxitron TRX5200 and incubating them for various recovery times at 25°C. All results are based from at least two biological replicates.
Images were collected using an Applied Precision Deltavision microscope and analyzed using SoftworX software. FRAP experiments were conducted using a 488 nm QLM laser (Applied Precision) at 1 micron bleach size and 100% intensity, and images acquired using adaptive settings. Pre-bleach signal was set to 100% and used to normalize recovery signals.

Colmenares S.U., Swenson J.M., Langley S.A., Kennedy C., Costes S.V, & Karpen G.H. (2017). Drosophila histone demethylase KDM4A has enzymatic and non-enzymatic roles in controlling heterochromatin integrity. Developmental cell, 42(2), 156-169.e5.

+ Open protocol

+ Expand

DENV2 Luciferase Assay in Aag2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

dsRNA KD was performed in RNA interference-competent Ae. aegypti (Aag2) cells. Aag2 cells were cultured in Schneider’s insect medium (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 1% non-essential amino acids and 10% fetal bovine serum (FBS). The cells were seeded in a 48-well plate at 50,000 cells/well for 24 h and subsequently transfected with 260 ng of dsRNA, against AaFAS1, DENV2 (positive KD control) or GFP (negative KD control) genes, mixed with TransIT-2020 Reagent (Mirus) following the manufacturer’s protocol. New medium with 2% FBS was replaced at 6 h post-transfection. Cell viability assays were performed at 2 days post-transfection using resazurin assay.
KD cells were infected with infectious DENV2 expressing a luciferase reporter (DEN-Luc) supplied by C. Rice, Rockefeller University. Cell culture medium was replaced with 300 µl of DEN-Luc supernatant at 48 h post dsRNA transfection, and cells were incubated at 28 °C without CO₂. Virus supernatant was removed at 24 h post-infection, and cells were lysed. Luciferase activity was read using the Luciferase Assay System (Promega) as per manufacturer protocol.

Chotiwan N., Brito-Sierra C.A., Ramirez G., Lian E., Grabowski J.M., Graham B., Hill C.A, & Perera R. (2022). Expression of fatty acid synthase genes and their role in development and arboviral infection of Aedes aegypti. Parasites & Vectors, 15, 233.

+ Open protocol

+ Expand

Cell Culture and Stimulation Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!