Semi-quantitative RT-PCR was conducted with purified RNA from mammalian cells [30 (link), 31 (link)]. One μg of RNAs purified using RNeasy kit (Qiagen) was used for synthesis of the first strand cDNA with a random hexamer (Roche) and Superscript III first-strand synthesis kit (Invitrogen). PCR was conducted with high fidelity 2X PCR master mix (NEB).
Random hexamer
Manufactured by Roche
Sourced in United States, Switzerland, Germany, Italy, Spain, France
Random hexamers are short, single-stranded DNA oligonucleotides that contain a random sequence of six nucleotides. They are commonly used as primers in reverse transcription and polymerase chain reaction (PCR) applications to initiate DNA synthesis from a variety of RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (19 mentions)
Superscript 2, by Thermo Fisher Scientific (12 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (11 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (10 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
M mlv reverse transcriptase, by Promega (7 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
Kapa sybr fast qpcr kit, by Roche (6 mentions)
Rotor gene q system, by Qiagen (6 mentions)
Lightcycler 96, by Roche (5 mentions)
Rneasy lipid tissue mini kit, by Qiagen (5 mentions)
Rneasy micro kit, by Qiagen (5 mentions)
High pure rna isolation kit, by Roche (5 mentions)
Expand reverse transcriptase, by Roche (5 mentions)
Cfx connect real time system, by Bio-Rad (4 mentions)
Rnase free dnase set, by Qiagen (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Dnase 1, by Thermo Fisher Scientific (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
116 protocols using random hexamer
1
Quantitative RT-PCR for Mammalian Cells
2
RNA Analysis of PFC/Brainstem Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA analysis (PFC/brainstem), tissues were homogenized in Qiazol, chloroform added, samples centrifuged at 12,000g, 15 min, 4°C, extractions performed with miRNeasy mini‐kit (QIAGEN), RNA concentration measured via absorbance at OD260nm and purity controlled (OD260/OD280). RNA (200 ng) was mixed with 0.6 pmol oligo dT‐mix, 120 pmol of Random‐Hexamer (Roche) and retro‐transcribed to cDNA with SuperScript®III Reverse‐Transcriptase‐Kit (Life‐Technologies). Derived cDNA (8 ng) was used as template for SYBR GREEN‐based real‐time PCR in Roche LightCycler 480. Samples were assayed in triplicate. Myelin mRNAs were normalized to 18s rRNA, microglia markers to the geometric mean of Gapdh, β‐Actin, Pbdg. Following primers were used:
Mbp F5′‐ACGGACACCCTTCCAAGTT‐3′ R5′‐GTGTGCCTCACCGTGAAAA‐3′,
Cnp F5′‐TAACCCTCCCTTAGCCCCTG‐3′ R5′‐GTCCCTAGCATGTGGCAGCT‐3′,
Plp F5′‐GGCTAGGACATCCCGACAAG‐3′ R5′‐GCAAACACCAGGAGCCATACA‐3′,
18s F5′‐GCTCTAGAATTACCACAGTTATCCAA‐3′ R5′‐AAATCAGTTATGGTTCCTTTGGTC‐3′
iNos F5′‐GGGCTGTCACGGAGATCA‐3′ R5′‐CCATGATGGTCACATTCTGC‐3′
Tnfα F5'‐GCCAACATCCCTACCTCTCC‐3' R5'‐CCCCAGGGCAAAGGTAAT‐3'
Arginase1 F5′‐AAGGAAAGTTCCCAGATGTACC‐3′ R5′‐GCAAGCCAATGTACACGATG‐3′
β‐Actin F5‘‐CTTCCTCCCTGGAGAAGAGC‐3’R5′‐ATGCCACAGGATTCCATACC‐3′
Gapdh F5′‐CAATGAATACGGCTACAGCAAC‐3′ R5′‐TTACTCCTTGGAGGCCATGT‐3′
Pbdg F5′‐ACAAGATTCTTGATACTGCACTCTCTAAG‐3' R5′‐CCTTCAGGGAGTGAACAACCA‐3′
Mbp F5′‐ACGGACACCCTTCCAAGTT‐3′ R5′‐GTGTGCCTCACCGTGAAAA‐3′,
Cnp F5′‐TAACCCTCCCTTAGCCCCTG‐3′ R5′‐GTCCCTAGCATGTGGCAGCT‐3′,
Plp F5′‐GGCTAGGACATCCCGACAAG‐3′ R5′‐GCAAACACCAGGAGCCATACA‐3′,
18s F5′‐GCTCTAGAATTACCACAGTTATCCAA‐3′ R5′‐AAATCAGTTATGGTTCCTTTGGTC‐3′
iNos F5′‐GGGCTGTCACGGAGATCA‐3′ R5′‐CCATGATGGTCACATTCTGC‐3′
Tnfα F5'‐GCCAACATCCCTACCTCTCC‐3' R5'‐CCCCAGGGCAAAGGTAAT‐3'
Arginase1 F5′‐AAGGAAAGTTCCCAGATGTACC‐3′ R5′‐GCAAGCCAATGTACACGATG‐3′
β‐Actin F5‘‐CTTCCTCCCTGGAGAAGAGC‐3’R5′‐ATGCCACAGGATTCCATACC‐3′
Gapdh F5′‐CAATGAATACGGCTACAGCAAC‐3′ R5′‐TTACTCCTTGGAGGCCATGT‐3′
Pbdg F5′‐ACAAGATTCTTGATACTGCACTCTCTAAG‐3' R5′‐CCTTCAGGGAGTGAACAACCA‐3′
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from FACS-isolated cells was performed using the RNAeasy Micro Kit (QIAGEN) according to the manufacturer’s recommendations with DNAse (deoxyribonuclease) treatment. After NanoDrop RNA quantification, the first-strand cDNA was synthesized using Superscript II (Invitrogen) and random hexamer (Roche) in 50 μl of final volume. Control of genomic contamination was measured for each sample by performing the same procedure with or without reverse transcriptase. qPCR assays were performed using 1 ng of cDNA as template, SYBR Green Mix (Applied Bioscience) and a LightCycler 96 (Roche) real-time PCR system. β-Actin housekeeping gene was used for normalization. Primers were designed using the Roche Universal Probe library assay design center: https://lifescience.roche.com/webapp/wcs/stores/servlet/CategoryDisplay?tab=Assay+Design+Center&identifier=Universal+Probe+Library&langId=-1 . qPCR analysis was performed using LightCycler 96 (Roche) real-time PCR system and the DDCT (Delta Delta CT) method with β-actin as a reference.
4
Quantitative Analysis of rRNA and GGGGCC Repeat RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells by TRIzol reagent (Thermo Fisher Scientific), and 1 μg purified RNA was then used for reverse transcription using the ImPromII Reverse Transcription System (Promega). Random hexamer (Roche) was used as the primer in reverse transcription. Real-time PCR was performed on a Bio-Rad CFX96 Real-time PCR system, and data were analyzed as previously described.29 (link) The following primers were used: human pre-45 s rRNA-F, 5′-GAACGGTGGTGTGTCGTT-3′; human pre-45 s rRNA-R, 5′-GCGTCTCGTCTCGTCTCACT-3′; human 28 s rRNA-F, 5′-AGAGGTAAACGGGTGGGGTC-3′; human 28 s rRNA-R, 5′-GGGGTCGGGAGGAACGG-3′; human 18 s rRNA-F, 5′-GATGGTAGTCGCCGTGCC-3′; human 18 s rRNA-R, 5′-GCCTGCTGCCTTCCTTGG-3′; human 5.8 s rRNA-F, 5′-ACTCGGCTCGTGCGTC-3′; human 5.8 s rRNA-R, 5′-GCGACGCTCAGACAGG-3′; human GGGGCC RNA-F, 5′-AGTACTCGCTGAGGGTG-3′; human GGGGCC RNA-R, 5′-TAGCGCGCGACTCCTGAG-3′; Human actin-F, 5′-TGTGCAAGGCCGGTT TCG C-3′; and human actin-R, 5′-CGACACGCAGCTCATTGTAG-3′.
5
Validation of EGFR and NF-κB Signaling Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 17 genes associated with EGFR signaling (AREG, TGFA, BTC, and HBEGF), NF-κB signaling pathway (BIRC3, NFKBIA, TNFAIP3, NFKB2, and RELB), chemotaxis, and immune system process (CXCL1, CXCL2, CXCL3, CXCL8, CXCL10, CXCL11, CCL20, and CSF1) that were found to be differentially expressed from DEGs analysis were selected and validated by RT-qPCR. Total RNA (2 μg) was used to synthesize cDNA using random hexamer (Roche, Basel, Switzerland) and M-MLV reverse transcriptase (Promega, Madison WI, USA) following the manufacturer’s protocols. RT-qPCR was conducted at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s using a SYBR-Green PCR Master Mix kit (Takara, Shiga, Japan) on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA). Gene-specific primers were obtained from OriGene technologies (Rockville, MD, USA). They are presented in Table S11 . The RT-qPCR analysis was conducted in triplicate independently. Target genes were normalized against GAPDH gene as an internal control. Relative expression levels of the selected genes were calculated with the 2−ΔΔCt method [64 (link)].
6
Automated qRT-PCR Quantification of Antibiotic Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed by using the GenUp Total RNA kit (BiotechRabbit), according to the manufacturer’s instructions. Five hundred nanograms of total cellular RNA were reverse-transcribed (RevertUP II Reverse Transcriptase, BiotechRabbit) into cDNA, using Random hexamer primers (Random hexamer, Roche Diagnostics, Germany), at 48 °C for 60 min, according to the manufacturer’s instructions. RT-PCR was carried out using: 2 μL of cDNA amplified in a reaction mixture containing 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2; 50 mM KCl; 10 µM dNTP; 10 µM forward and reverse primers (mecA, mec1, mecR1), or 1 µM forward and reverse 16S rRNA primers; and 2.5 U of Taq DNA polymerase (BiotechRabbit) in a final volume of 25 µL. The cycling conditions are reported in Table 2 . The reaction was carried out in a DNA thermal cycler (MyCycler, Biorad, USA). The PCR products were analyzed by electrophoresis on 1.8% agarose gel in TBE, and analyzed on a Gel Doc EZ System (BioRad). Quantification data were normalized to the reference gene for the 16S rRNA gene and analyzed by Image Lab software 5.2.1 (BioRad).
7
RT-qPCR Analysis of Cell Survival Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 18 genes related to cell survival and epithelial development (AREG, EREG, HBEGF, EPGN, FASLG, GLI2, CDKN1A, FOSL1, MYC, SERPINE1, TNFSF10, BCL6, FLG, IVL, SPRR1A, SPRR1B, SPRR3, and MUC5AC) were selected and validated by RT-qPCR. Total RNAs (2 μg) were transcribed to cDNAs using random hexamer (Roche, Basel, Switzerland) and M-MLV reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocols. RT-qPCR was carried out under the condition at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s using a SYBR-Green PCR Master Mix kit (Takara, Shiga, Japan) on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA). Gene-specific primer sets for these selected genes were obtained from OriGene technologies (Rockville, MD, USA). They are listed in Table S1 . RT-qPCR analysis was performed in triplicate independently. Target genes were normalized against GAPDH gene as a reference. Relative expression levels of targeted genes were calculated with the 2−ΔΔCt method [37 (link)].
8
Abietic Acid Modulates MRSP Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MRSP strain was treated with sub-MIC concentration (16 μg/mL) of abietic acid for 30 min. Total RNA was isolated by using GenUp Total RNA kit (BiotechRabbit, Berlin, Germany) according to the manufacturer’s instructions. DNA contamination from the total RNA was removed by incubation with DNase I (RNase-free DNase Set, Qiagen, Hilden, Germany). Measuring A260/A280 nm ratio assessed the nucleic acid purity. To generate cDNA, total RNA was reverse transcribed by using (RevertUP II Reverse Transcriptase, BiotechRabbit, Berlin, Germany) into cDNA using Random hexamer primers (Random hexamer, Roche Diagnostics, Monza, Italy) at 48 °C for 60 min according to the manufacturer’s instructions. RT-PCR was carried out using 2μl of cDNA. Quantification data were normalized to the reference gene for 16S rRNA gene and analyzed by Image Lab software 5.2.1 (Bio-Rad, Milan, Italy).
9
Quantitative Analysis of Fly RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells or ten 12 day-old adult fly heads by Trizol reagent (Life Technologies), and 1 μg of purified RNA was then used for reverse-transcription using the ImPromII™ Reverse Transcription System (Promega). Random hexamer (Roche) was used as primers in reverse transcription. Taqman gene expression assays were performed on an ABI 7500 Real-time PCR system and data were analyzed as previously described13 (link). The following probes were used: pre-45s rRNA (Assay ID: AILJIZM), pre-rRNA (Assay ID: AIMSG5U), Drosophila GAPDH (Assay ID: Dm01841186) and human actin (Assay ID: Hs99999903_m1). Each experiment was repeated at least 3 times.
10
Validation of Differential Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primers used for RT-qPCR are listed in Table S2 (Supplementary File S2 ). A total of 8 genes (cotD, spoIIID, yqfX, spmH, gsiB, frlO, cheY, and gbsB) that were found to be most up- and down-regulated DEGs according to fold change were selected and validated by RT-qPCR. One μg of RNA was used to synthesize cDNA using random hexamer (Roche, Base, Switzerland) and M-MLV reverse transcriptase (Promega, Madison, SI, USA), following the manufacturer’s protocols. RT-qPCR was conducted at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA). The RT-qPCR analysis was conducted in triplicate independently. The target genes were normalized against rpsJ gene as an internal control. The relative expression levels of the target genes were calculated with the 2−ΔΔCt method [23 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!