Color sybr green qpcr master mix
Color SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescent signals during the amplification process, allowing for real-time detection and quantification of DNA targets.
Lab products found in correlation
21 protocols using color sybr green qpcr master mix
Quantitative PCR Analysis of Gene Expression
Quantifying miR-34a Expression in Cells
MiR34a expression was measured with Color SYBR Green qPCR Master Mix (EZBioscience, USA) by using the Roche LightCycler96 Real-Time PCR system (Roche Applied Science, Rotkreuz, Switzerland). The amplification program was 40 cycles of denaturing at 95 °C for 10 s, annealing at 60 °C for 30 s, and extension at 60 °C for 30 s. MiR-34a and U6 were purchased from RiboBio (Guangzhou, China). The sequences of specific primers were used as follows:
miR-34a forward:5’-ACACTCCAGCTGGGTGGCAGTGTCTTAGCTGGT-3’,
Reverse:5’-CTCAACTGGTGTCGTGGA-3’;U6forward:5’-GCTTCGGCAGCACATATACTAA-3’, reverse: 5’-AACGCTTCACGAATTTGCGT-3’. The expression level of miR-34a was defined from the Ct. U6 was used as an endogenous control. The 2−ΔΔt method was used for relative quantification after normalization.
Quantitative Real-Time PCR Protocol
Comprehensive RNA Extraction and Quantification
Gene Expression Analysis using qRT-PCR
qRT-PCR Quantification of Inflammatory Genes
Primers used in qRT-PCR experiments (mouse origin).
Gene | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
---|---|---|
Tumor necrosis factor alpha (Tnfa) | AATGGCCTCCCTCTCATCAGTT | CCACTTGGTGGTTTGCTACGA |
Inducible nitric oxide synthase (iNos) | GCTTCTGGTCGATGTCATGAG | TCCACCAGGAGATGTTGAAC |
Arginase 1 (Arg1) | AAGACAGCAGAGGAGGTG | AGTCAGTCCCTGGCTTAT |
Interleukin-1 receptor antagonist (Il1ra) | CTCCAGCTGGAGGAAGTTAAC | CTGACTCAAAGCTGGTGGTG |
RNA Extraction and qRT-PCR Analysis
Quantitative PCR Methodology for Gene Expression
RNA Extraction and qPCR Quantification
qPCR Analysis of Inflammatory Markers
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!