The largest database of trusted experimental protocols

18 protocols using anti trpm7

1

Immunoblotting Analysis of Cardiac Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples (homogenised cardiac tissue or CFs) were analysed by immunoblotting using the NuPAGE system as previously described [19 (link), 20 (link)]. DMT1 protein was detected using an overnight incubation in anti-DMT1 (rabbit polyclonal, Sigma-Aldrich) at 1:800 dilution. TRPM7 and TRPC6 proteins were detected using anti-TRPM7 (rabbit polyclonal, Abcam) at 1:500 dilution and TRPC6 (rabbit polyclonal, Sigma–Aldrich) at 1:500 dilution, respectively. GAPDH protein was detected as a loading control (mouse polyclonal, Abcam). All membranes were then subjected to a 2-h incubation in peroxidase-conjugated anti-rabbit or anti-mouse IgG prior to incubation in chemiluminescence reagent and exposure onto X-ray film. Protein bands were quantified using a GS-800 imaging densitometer and Quantity One software (BioRad).
+ Open protocol
+ Expand
2

Western Blot Analysis of Autophagy and Apoptosis Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Radioimmunoprecipitation assay (RIPA) buffer was used to obtain cell lysates from both SH-SY5Y cells, and SNpc region of the brain. Protein concentrations were determined, using the Bradford reagent (Bio-Rad), and 25 ug of lysates were resolved on NuPAGE 4–12% Bis-Tris gels (Invitrogen, Carlsbad, CA) followed by Western blotting as described [25 (link), 26 (link)], using the following monoclonal or polyclonal antibodies: anti-TRPM7 (Abcam, MA; Cat# 109438; Dilution in 1:500), anti-LC3A (Cell Signaling, MA; Cat# 4599; Dilution in 1:1000), anti-Bcl2 (Cell Signaling, MA; Cat# 209039; Dilution 1:1000), anti-Bax (Cell Signaling, MA; Cat# 5023; Dilution used was 1:1000), anti-Caspase3 (Cell Signaling, MA; Cat# 9662; Dilution used was 1:2000), anti-β-Actin (Cell Signaling, MA; Cat# 4970; at 1:2000 dilution)
+ Open protocol
+ Expand
3

Western Blot Analysis of Protein Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins were extracted from lung tissue and cell samples through homogenization in RIPA lysis and extraction buffer (ThermoFisher Scientific) according to the manufacturers’ instructions. After denature in SDS loading buffer, protein samples were separated by 8% or 10% SDS-PAGE and then transferred to PVDF membranes (Millipore). After block with 5% BSA diluted in TBST, the membranes were probed overnight at 4 °C with the following primary antibodies: anti-TRPM7 (Abcam, ab729), anti-β-actin (Santa Cruz, sc-81178), anti-cleaved caspase-3 (Cell Signaling Technology, 9661), anti-p-MEK 1/2 (Santa Cruz, sc-81503), anti-MEK 1/2 (Santa Cruz, sc-81504), anti-p-ERK 1/2 (Santa Cruz, sc-81492), anti-ERK 1/2 (Santa Cruz, sc-292838). After wash with TBST, the membranes were further incubated with secondary antibodies conjugated with horseradish peroxidase (HRP). Protein bands were detected by chemiluminescence with the ECL detection reagent (Amersham Biosciences). The densitometric analysis of protein bands was performed by ImageJ software [48 (link)]. Results were normalized to those of β-actin.
+ Open protocol
+ Expand
4

Quantitative Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting experiments were carried out according to our previous study [26 (link), 27 (link)]. Briefly, cells were lysed in RIPA buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 10 ng/mL PMSF, 0.03% aprotinin, and 1 μM sodium orthovanadate) on ice for 30 min. Protein concentration of samples was measured with the bicinchoninic acid (BCA) assay method. Proteins were separated on 8–12% SDS-PAGE gels and transferred to nitrocellulose membrane (Millipore, USA). Membranes were blocked with 5% BSA in TBS with 0.1% tween-20 and incubated with primary antibodies as follows: anti-TRPM7 (1 : 1000, Abcam, #ab85016, USA), anti-p-Akt-Ser473 (1 : 1000, Cell Signaling Technology, #4060, Inc., USA), anti-Akt (1 : 1000, Cell Signaling Technology, #2920 Inc., USA), phospho-p44/42 MAPK (p-ERK1/2, 1 : 1000, Cell Signaling Technology, #8544, Inc., USA), anti-ERK1/2 (1 : 1000, Cell Signaling Technology, #4696, Inc., USA), and anti-β-actin (1 : 1000, Cell Signaling Technology, #3700, Inc., USA) antibodies followed by incubation with corresponding horseradish peroxidase-conjugated secondary antibodies were used against each primary antibody. Bands were developed with a chemiluminescence reagent system (Beyotime, China).
+ Open protocol
+ Expand
5

RNA Extraction and Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA isolation, cDNA synthesis and PCR amplification for the following genes, immunoblotting and quantification of immuno-detectable bands were performed as previously described 20 (link). Primary antibodies used include: anti-pSTAT3/tSTAT3, anti-pJAK2(Tyr1007/1008)/tJAK2, anti-pAKT/tAKT (Cell Signaling Technology, Danvers, MA), anti-TRPM7 (Abcam, catalog number: ab85016, Cambridge, MA), anti-CD133, anti-ALDH1, anti-Hey2, ati-Survivin and anti-β-actin (Sigma-Aldrich, St. Louis, MO). PCR primers used for TRPM7 (5′-3′) were: GCCACCAAGGAGGTACACAT and CTTCCAGGGCCGTGTAGATA, ALDH1 (5′-3′) were: CCCTTTGGTGGATTCAAGAT and TTGAAGAGCTTCTCTCCACTCTT, CD133 (5′-3′) were, CAGAAGGCATATGAATCCAAAA and ATAAACAGCAGCCCCAGGAC, Notch1 (5′-3′) were, CAC TGT GGGCGGGTCC and GTTGTATTGGTTCGGCACCAT, Survivin (5′-3′) were, GCCCAGTGTTTCTTCTGCTT and CCTCCCAAAGTGCTGGTATT, Hey2 (5′-3′) were, AAAAAGCTGAAATATTGCAAATGA and GTACCGCGCAACTTCTGTT, Jagged1(5′-3′) were, GACTCATCAGCCGTGTCTCA and TGGGGAACACTCACACTCAA, WNT1(5′-3′) were GCGCTTCCTCATGAACCTT and GTGCATGAGCCGACATC, Notch2(5′-3′) were, AATCCCTGACTCCAGAACG and TGGTAGACCAAGTCTGTGATG AT, Sox11(5′-3′) were, GACCCAGACTGGTGCAAGAC and GCCCAGCCTCTTGGAGAT, GAPDH (5′-3′) were, GAAGGTGAAGGTCGGAGTC and GAAGATGGTGATGGGATTTC.
+ Open protocol
+ Expand
6

TRPM6/TRPM7 Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris, pH = 8, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% NP-40, 0.05% sodium deoxycholate, and 0.1% SDS) supplemented with protease inhibitors (10 μg/mL leupeptin, 20 μg/mL aprotinin, 1 mM phenylmethanesulfonyl fluoride, 1 mM NaVO4, and 100 mM NaF). Protein concentrations were determined using the Bradford protein assay (Bio-Rad Laboratories Srl., Segrate (MI), Italy). Cell extracts (50 μg) were resolved by SDS-PAGE (8%), transferred to polyvinylidene fluoride (PVDF) membranes, and probed with rabbit monoclonal anti-TRPM7 (1:1000, Abcam Ltd., Cambridge, UK), rabbit polyclonal anti-TRPM6 (1:500, Biorbyt Ltd., Cambridge, UK), rabbit polyclonal anti-tubulin or actin (1:1000, Sigma-Aldrich Srl., Milan, Italy) primary antibodies. Horseradish peroxidase-conjugated secondary antibodies (GE Healthcare Srl., Milan, Italy) were detected by use of the ECL Prime Western Blotting Detection Reagent (GE Healthcare Srl, Milan, Italy) and the ChemiDoc XRS system (Bio-Rad Laboratories Srl., Segrate (MI) Italy).Densitometric analysis was performed by using the National Institutes of Health (NIH) ImageJ software.
+ Open protocol
+ Expand
7

Protein Quantification and Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total proteins were extracted using RIPA lysis buffer. Proteins were separated on SDS-PAGE, and transferred to nitrocellulose filter membranes, which were probed with the following antibodies overnight at 4°C: anti-TRPM7 (1:1000; Abcam, Cambridge, MA, USA), anti-β-actin antibodies. Immunocomplexes were detected with an enhanced chemiluminescence blotting kit (Applygen Technology Inc., Beijing, China).
+ Open protocol
+ Expand
8

Western Blot Analysis of TRPM7

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibody and reagents: Primary antibodies used included anti-TRPM7 (Abcam, Cat no. ab232455, Cambridge, MA) and anti-β-actin (Sigma-Aldrich, St. Louis, MO, Cat no. A3854). Rabbit polyclonal Rap1b (36E1, Cat no. 2326) and mouse HA (Cat no. 2367) antibodies were purchased from Cell Signaling Technology (Danvers, MA). All secondary antibodies used for Western blot were purchased from Calbiochem (La Jolla, CA).
+ Open protocol
+ Expand
9

Magnesium-Induced Cellular Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols
Following the stimulation of DMEM containing different concentrations of Mg2+, cells were washed with 1× PBS three times, permeabilized with 0.2% Triton X-100 for 10 min either before or after fixation with 4% paraformaldehyde. The primary antibodies used include anti-TRPM7 (Abcam), anti-NF-κB p65 (CST), and anti-Phospho-H3S10 (Abcam). The secondary antibodies used include Alexa-Fluor 488 conjugated anti-rabbit IgG (Thermo Fisher Scientific), Alexa-Fluor 647 conjugated anti-mouse IgG (Thermo Fisher Scientific). FITC-Phallotoxins (Sigma-Aldrich) and Hoechst 33342 (ThermoFisher Scientific) were used for counterstain. The fluorescent images were captured using a Carl Zeiss LSM 780 confocal microscopy (Carl Zeiss, Germany).
+ Open protocol
+ Expand
10

Protein Expression Analysis in SH-SY5Y Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lysates (differentiated SH-SY5Y cells) under different conditions (as labeled in the figures) were obtained using NP40 or 0.5% SDS treatment for 15 min on ice followed by centrifugation at 10,000 × g for 15 min at 4°C. Protein concentrations from all treatments as labeled in the figures were evaluated using the Bradford reagent (Bio-Rad) and 25 μg of total lysates from individual samples were resolved on NuPAGE 4–12% Bis-Tris gels. Western blotting were performed using specific antibodies (Singh et al., 2000 (link); Selvaraj et al., 2009 (link)). The antibodies used were the following monoclonal or polyclonal antibodies: anti-TRPM7 (Abcam, MA; Cat# 109438; 213 kDa; Dilution in 1:500), anti-Bcl2 (Cell Signaling, MA; Cat# 209039; Dilution used were 1:1000), anti-Bax (Cell Signaling, MA; Cat# 5023; Dilution used was 1:1000), anti-β-Actin (Cell Signaling, MA; Cat# 4970, at 1:2000 dilution) and anti- β2-AR (Abcam, MA; Cat# ab36956; Dilution used was 1:1000). The methods described here are taken from our previous publication (Sun et al., 2018 (link)).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!