Mgcl2

To confirm morphological identification of collected ticks, at least 10 specimens from each locality were intended for molecular research by polymerase chain reaction (PCR), based on the fragment of the mitochondrial 16 S rRNA gene (rDNA) with cycling conditions according to Black and Piesman (1994 (link)). The PCR assay was carried out in a 50 µl reaction solution containing 1 U of the Taq DNA Polymerase and reaction buffer with 15 mM MgCl₂ (Qiagen, Germany), 0.5 µM of each primer (16S1 and 16S2), 0.2 mM of each dNTP, 1.5 µl DNA template and nuclease-free water.

Deoxyribonucleic acid (DNA) was extracted using the Qiagen DNA mini prep kit (Qiagen, Hilden, Germany), following the manufacturer’s instruction. Amplification of a 515-bp product was performed using the primers MU1-new (5′-GAT CAA GCG TTC ACG AGT GA-3′) and MU2 (5′-GGC AGT TAC TTC ACT GCA CA-3′).¹⁰ The 50-μl PCR contained 5 μl 10× PCR buffer with 15 mM MgCl₂ (QIAGEN), primers MU1 and MU2 at a final concentration of 1 μM, deoxynucleoside triphosphates (200 μM each) and 2.5 U Taq polymerase (QIAGEN), and 1 ng of M. ulcerans genomic DNA [18 (link)]. The amplification conditions were as previously indicated [11 ] and the amplicons detected after ethidium bromide staining.

DNA samples for hybridization on the microarray were prepared using two-stage asymmetric multiplex PCR. The reaction mixture contained 0.25 mM each of dATP, dCTP, dGTP, 0.125 mM of dUTP and dTTP (Evrogene, Moscow, Russia), 6.6 μM of Sulfo-Cyanine 5 dUTP (Lumiprobe, Moscow, Russia), 2.5 U Taq DNA polymerase (Qiagen, Hilden, Germany), 1 μL of primer mix containing 1 pmol/μL of each specific primer, 1 pmol/μL forward adapter primer and 100 pmol/μL reverse adapter primer, 3.3 μL 10 × PCR Buffer (Qiagen), 5.1 mM MgCl₂ (Qiagen), and at least 10 ng of genomic DNA in a final volume of 33 μL. Amplification was performed on a C1000 Touch Thermal Cycler (BioRad, Hercules, CA, USA). The reaction mixture was incubated at 95 °C for 10 min followed by 25 cycles of 30 s at 95 °C, 70 °C, and 72 °C at the first PCR stage and then 49 cycles of 30 s at 95 °C, 54 °C, and 72 °C at the second PCR stage. Finally, the mixture was incubated for 5 min at 72 °C.
The mixture for hybridization analysis contained 33 μL of the PCR reaction mixture and 9 μL of a solution containing 4 M guanidine thiocyanate, 200 mM HEPES, and 20 mM EDTA (Sigma-Aldrich, St. Louis, MO, USA), pH 7.5. The resulting mixture was infused into a microarray chamber and incubated for 6 h at 37 °C. After hybridization, the microarray was washed twice with distilled water for 30 s at 37 °C and then dried.

As a comparison with our new SNP typing approach, we compared parentage assignment for eight insurance population offspring that were also genotyped using microsatellites. Twelve existing microsatellite markers designed for the devil (six MHC linked loci [52 (link)]) and six anonymous loci [53 (link)] were used (Additional file 1: Table S5). PCR was carried out on devil genomic DNA in a total volume of 10 μl, containing 2x Type-it Multiplex PCR Master Mix including 3 mM MgCl2 (Qiagen), and 0.2 μM of each primer. PCR amplifications were performed on a BioRad T100 Thermal Cycler at the following conditions: 95 °C initial activation for 5 min; 28 cycles of 95 °C denaturation for 30 s, 60 °C annealing for 90 s, 72 °C extension for 30 s followed by a 60 °C final extension for 30 mins. PCR products were checked on a 1.2 % TBE agarose gel. The amplified products were separated by electrophoresis on an ABI 3130XL Genetic Analyser (Applied Biosystems) and scored against the size marker LIZ 500 using Genemarker v 1.95 (Soft Genetics LLC).

The mycobacteria ITS region(s) were amplified prior to CGE analysis using a 6-FAM labelled ITS1F forward primer 5′ GTGCGGCTGGATCACCTCCT 3′ and a ITS1R reverse primer 5′ AGCCTCCYACGTCCTTC(A/T)TCGGCT 3′ (Sigma-Aldrich, Castle Hill, NSW, Australia). Sequencing of the ITS region was performed for M. chelonae, M. abscessus and M. massiliense using an ITS2F forward primer 5′ GAAGTCGTAACAAGGTAGCCG 3′ and a ITS2R reverse primer 5′ GACAGCTCCCCGAGGC(A/T)TATCGCA 3′ (Sigma-Aldrich). Each PCR mixture was made to a total volume of 25 µL consisting of 5 µL of DNA extract, 0.5 µM forward and reverse primers, 2.5 mM deoxynucleoside triphosphates (Roche, Castle Hill, Australia), 10× PCR buffer containing 15 mM MgCl₂ (Qiagen, Doncaster, Victoria, Australia), 0.5 U HotStarTaq DNA polymerase (Qiagen) and molecular biology-grade H₂O (Eppendorf, North Ryde, Australia). PCR conditions were 95°C for 15 minutes and then 35 cycles of 95°C for 30 seconds, 62°C for 30 seconds, 72°C for 1 minute, followed by a further extension at 72°C for 10 minutes.