Feces and intestinal contents were diluted 1:5 in DMEM and centrifuged at 5,000 × g for 10 min at 4°C, and the supernatant was collected for viral RNA extraction. The total RNA was extracted by using an RNeasy minikit (Qiagen, Valencia, CA). Reverse transcription (RT) was conducted using a primer (5′ TTTTGCTCCATCCCCCCTATAAGC 3′) targeting the 3′-end UTR of PdCV and the Superscript III transcriptase kit (Invitrogen, Carlsbad, CA). The RT products were then used to perform real-time PCR using primers and probes specifically targeting the N gene of PdCV (forward, 5′ CGCTTAACTCCGCCATCAA 3′; reverse, 5′ TCTGGTGTAACGCAGCCAGTA 3′; probe, 5′ 6FAM-CCCGTTGAAAACC-MGB 3′ [6FAM is 6-carboxyfluorescein] [Applied Biosystems, Foster City, CA]) in a StepOne real-time PCR system (Applied Biosystems). A standard plasmid for PdCV was constructed by inserting the sequence of the entire PdCV N gene into the pGEM-T Easy vector (Promega, Madison, WI). Amplification cycles used were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. The threshold for detection of fluorescence above the background was set within the exponential phase of the amplification curves. For each assay, 10-fold dilutions of standard plasmid were generated, and negative-control samples and double-distilled water (ddH2O) were included in each assay.
Superscript 3 transcriptase kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Superscript III transcriptase kit is a reverse transcriptase enzyme used for cDNA synthesis from RNA templates. It offers robust performance and high thermal stability.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Recoverall total nucleic acid isolation kit, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Paxgene blood rna kit, by Qiagen (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cytoplasmic nuclear rna puri cation kit, by Norgen Biotek (1 mentions)
Rneasy minelute purification kit, by Qiagen (1 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
Quantstudio 12k flex, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
9 protocols using superscript 3 transcriptase kit
1
Quantitative RT-PCR for Porcine Deltacoronavirus
2
FFPE RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 10 μm thick FFPE sections using the Recover All Total Nucleic Acid isolation kit (Ambion Inc., Austin, TX). Total RNA (500 ng) was treated with DNAse and reverse-transcribed into cDNA with oligo-dT12–18 (50 μM) and random hexamers (50 ng) using a Superscript III transcriptase kit (Invitrogen Corp., Carlsbad, CA).
3
Quantitative Analysis of miR-485-5p and YAP1 in Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of RNA from venous blood was carried out using PAXgeneTM Blood RNA kit (Qiagen, Hilden, Germany), and all extraction steps were performed according to the instructions attached to the kit. The extraction of total RNA from the cells was performed using TRIzol reagent (Thermo Fisher Scientific) method. The extracted total RNA was washed with 75% ethanol and dissolved in DEPC water. NanoDrop™ 2000/2000c spectrophotometer was used to detect the concentration of RNA (DEPC water was used as a negative control). 5 μg of total RNA was reverse transcribed to cDNA using a Superscript III transcriptase kit (Invitrogen, 18080093). The quantification of cDNA was performed on the 7500 Real Time PCR System (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) using SYBR premix EX TAQ II kit (Takara, Dalian, China). Experimental results were analyzed using the 2-ΔΔCt method. GAPDH was used as the internal reference gene.44 (link)
The primers were synthesized by Sangon Biotechnology Co, Ltd (Shanghai, China) as below: miR-485-5p (F: 5′-ACTTGGAGAGAGGCTGGC-3′, R: 5′- AAAAGAGAGGAGAGCCGTGT -3′; YAP1 (F: 5′-TTTTACCGCGTCTCCCTG
ATT -3′, R: 5′-AGAAACACCTGGGCTAGTAGAAA-3′); GAPDH (F: 5′-GACAGT
CAGCCGCATCTTCT-3′, R: 5′-GCGCCCAATACGACCAAATC-3′).
The primers were synthesized by Sangon Biotechnology Co, Ltd (Shanghai, China) as below: miR-485-5p (F: 5′-ACTTGGAGAGAGGCTGGC-3′, R: 5′- AAAAGAGAGGAGAGCCGTGT -3′; YAP1 (F: 5′-TTTTACCGCGTCTCCCTG
ATT -3′, R: 5′-AGAAACACCTGGGCTAGTAGAAA-3′); GAPDH (F: 5′-GACAGT
CAGCCGCATCTTCT-3′, R: 5′-GCGCCCAATACGACCAAATC-3′).
4
Comprehensive RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was carried out using Trizol (Invitrogen, Cat. No. 15596-026). Reverse transcription was carried out using the Superscript III transcriptase kit (Invitrogen, Cat. No. 18080-044). RT-qPCR was conducted on the Biorad CFX96 system using SYBR green. Table 4 exhibits the primer sequences utilized. RT-qPCR was executed through the following process: 55°C for 3 minutes, 95°C for 7.5 minutes, and subsequently 50 cycles at 95°C for 10 seconds, and 65°C for 2 minutes. The next step was done at 95°C for 2 minutes, 50°C for 1 minute, and 50°C for 10 seconds. GAPDH was used as the reference gene. The PureLink® miRNA kit was used for mining of miRNAs. The RT-qPCR formula was as follows: 95°C for 3 minutes, followed by 50 cycles at 95°C for 10 seconds, and 55°C for 50 seconds. The reference genes were U6 and/or β-actin. All sequences for RT-qPCR are outlined in Table 3.
5
Comprehensive RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was done using Trizol (Invitrogen, Cat. No. 15596-026). Reverse transcription was done using Superscript III transcriptase kit (Invitrogen, Cat. No. 18080-044). RT-qPCR was conducted on the Biorad CFX96 system using SYBR green. Primer sequences used are shown in Table 4. RT-qPCR was done using the following protocol: 55°C for 3 minutes, 95°C for 7.5 minutes, followed by 50 cycles at 95°C for 10 seconds, and 65°C for 2 minutes. The extension step was done at 95°C for 2 minutes, 50°C for 1 minute, and 50°C for 10 seconds. GAPDH was used as the reference gene. The PureLink® miRNA kit was used for extraction of miRNAs. The RT-qPCR protocol was as follows: 95°C for 3 minutes, followed by 50 cycles at 95°C for 10 seconds, and 55°C for 50 seconds. The reference genes were U6 and/or β-actin.
Table 4 The sequences for RT-qPCR Isolation of cytoplasmic and nuclear RNA Cytoplasmic and nuclear RNA isolation and puri cation were done using cytoplasmic & nuclear RNA puri cation kit (Norgen, Cat. No. 21000) following manufacturer's instructions.
Table 4 The sequences for RT-qPCR Isolation of cytoplasmic and nuclear RNA Cytoplasmic and nuclear RNA isolation and puri cation were done using cytoplasmic & nuclear RNA puri cation kit (Norgen, Cat. No. 21000) following manufacturer's instructions.
6
Comprehensive RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was carried out using Trizol (Invitrogen, Cat. No. 15596-026). Reverse transcription was carried out using the Superscript III transcriptase kit (Invitrogen, Cat. No. 18080-044). RT-qPCR was conducted on the Biorad CFX96 system using SYBR green. Table 4 exhibits the primer sequences utilized. RT-qPCR was executed through the following process: 55°C for 3 minutes, 95°C for 7.5 minutes, and subsequently 50 cycles at 95°C for 10 seconds, and 65°C for 2 minutes. The next step was done at 95°C for 2 minutes, 50°C for 1 minute, and 50°C for 10 seconds. GAPDH was used as the reference gene. The PureLink® miRNA kit was used for mining of miRNAs. The RT-qPCR formula was as follows: 95°C for 3 minutes, followed by 50 cycles at 95°C for 10 seconds, and 55°C for 50 seconds. The reference genes were U6 and/or β-actin. All sequences for RT-qPCR are outlined in Table 3.
7
Microarray Analysis of Cellular RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were submitted to the Shanghai Kangcheng Biological Engineering Tech-nology Co. Ltd. for microarray analysis. The experimental steps were as follows: in accordance with manufacturer protocol, total cellular RNA was extracted following tissue homogenization (TRIZOL; Invitrogen, Carlsbad, CA, USA). RNA was purified according to the RNeasy ® Min-Elute TM Purification Kit (Qiagen, Dusseldorf, Germany) manufacturer protocol; RNA concentration and purity was determined by UV spectrophotometry; and its integrity was ascertained by denaturing agarose gel electrophoresis. RNA was reverse transcribed to cDNA using the SuperScript III Transcriptase kit (Invitrogen). Real-time quantitative PCR was performed using the 96-Well RT2 Profiler TM PCR Array (Qiagen) according to the manufacturer protocol as follows: after appropriate dilution, the cDNA template was added to the real-time quantitative reaction mixture, and equal amounts of reaction liquid were added to each well of the PCR array, containing gene specific primers. Conditions for the real-time quantitative PCR reaction were as follows: denaturing at 95°C for 10 min, 40 amplification cycles of annealing at 95°C for 10 s, and extension at 60°C for 1 min, followed by acquisition of fluorescence signal. Data analysis is based on the ΔΔCt method with normalization raw data to housekeeping genes by SKBET.
8
Quantifying Gene Expression in Rice Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the leaves of 2‐week‐old seedlings with Trizol reagent (ThermoFisher, Cat. # 15596026, Waltham, MA, USA) and then reverse‐transcribed into cDNA using the SuperScript III transcriptase kit (ThermoFisher, Cat. # 18080093). RT–qPCR analysis was conducted using SYBR green master mix (Bio‐Rad, Cat. # 1725150, Hercules, CA, USA) on the CFX96 real‐time detection system 690 (Bio‐Rad, USA). The rice Ubiquitin (LOC_Os03g13170) gene was used as an internal control (Wang et al., 2018 (link)). The mRNA levels relative to the Ubiquitin level were calculated according to the 2−∆∆Ct method.
9
Quantifying Signaling Effects of Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the signaling effect triggered by the presence of mutations, we measured the mRNA expression of downstream target genes by qRT-PCR. Total RNA (1 μg) was treated with DNAse and reverse-transcribed into cDNA with 50-μM oligo(dT)20 using a Superscript III transcriptase kit (Thermo Fisher Scientific). About 2 μL of cDNA was used in a 12-μL PCR reaction containing 1× SYBR Green PCR Master Mix (Applied Biosystems) and 3 pmol of each specific primer for the target gene. As a reference gene, we used ribosomal protein S8 (RPS8). The reaction was performed in triplicate on a QuantStudioTM 12K Flex (Applied Biosystems). The relative expression levels were calculated based on Delta-Delta-CT (ddCT), as previously reported [42 (link),43 (link)]. The Kruskal-Wallis test was applied to analyze our set of candidates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!