Myc ddk tagged

Hic-5 ectopic expression was performed as previously described [109 ]. Briefly, cDNA of the human Hic-5 gene (Myc-DDK-tagged) cloned in the pCMV6 entry eukaryotic expression vector (pCMV-Hic-5) was purchased from OriGene Technologies, Inc. (Rockville, MD). Transfection with ExGen 500 (Fermentas Canada Inc., Burlington ON) was carried out according to the manufacturer’s guidelines. Briefly, 1x10⁵ A2780s cells were plated onto 6x30-mm well plates and allowed to grow to 70% confluence. Ten microliters of ExGen 500 were added to 2 μg of plasmid DNA dissolved in 190 μl of 150 mM NaCl. The complexes were incubated at room temperature for 10 min and then overlaid onto the cells in 1.8 ml medium. The plates were then incubated at 37°C, 5% CO₂ for 48 hr. Stably transfected clones were selected by adding neomycin (500 μg/ml) and were further cultivated for about 2 weeks. Cells were also mock-transfected with the empty pCMV6 vector, and stably transfected clones were isolated as controls. Western blot analyses of the Hic-5 and the DDK protein expression levels were performed for validation of Hic-5 overexpression of the selected Ctrl and Hic-5-overexpressing clones.

Cells (0.4 × 10⁶ per 60 mm or 0.8 × 10⁶ per 100 mm culture dish) were transfected with siRNAs against STAMBPL1, AMSH, Cul3 (Eurofins Genomics), Cul1 (Dharmacon), CSN2, and CSN5 (Thermo Fisher Scientific) using METAFECTENE^® PRO transfection reagent (Biontex) according to the manufacturer’s protocol. The siRNAs were used at a final concentration of 50 nM for STAMBPL1 and AMSH, and 40 nM for Cul1, Cul3, CSN2, and CSN5. A scrambled siRNA (Dharmacon) was used as a negative control. Knockdown cells were harvested 24 h after siRNA transfection or at times indicated in the figures. All siRNA sequences used in this study are listed in Supplementary Materials Table S1.
For overexpression of STAMBPL1 protein, AGS cells were transfected with 1 μg of pCMV-STAMBPL1 containing Myc-DDK tagged (OriGene) by using METAFECTENE^® PRO transfection reagent. Six hours after transfection, the medium was changed to fresh RPMI 1640 containing 10% FCS.

Recombinant human SIRT2 protein (Sigma-Aldrich, St. Louis, MO, CAT# SRP0116), Human recombinant PFKP protein (His and GST tag), Sino Biological, Wayne, PA, USA, CAT# 15003-H20B), Biacore series S Sensor Chip CM5 (Cytiva, Marlborough, Massachusetts, USA CAT# 29104992), NAD⁺ (nicotinamide adenine dinucleotide, Sigma Aldrich, St. Louis, MO, CAT# 10127973001).
Biologicals for PFKP overexpression in HEK293T cells: mouse wtPFKP (turbo-GFP-tagged) shRNA (Origene, Rockville, MD, CAT# MG210641), KAT5 mouse plasmid (Origene, Rockville, MD, CAT# TR512714), SIRT2 (Myc-DDK-tagged) ShRNA (Origene, Rockville, MD, CAT# MR225715), transfection reagent (Thermo scientific, CAT# R0531), control plasmids (control turbo GFP plasmid pCMV6-AC-GFP (Origene, Rockville, MD, CAT# PS100010), control pCMV6-Entry plasmid (Myc-DDK-tagged; Origene, Rockville, MD, CAT# PS100001), Opti-MEM reduced serum medium (Thermo Fisher Scientific, Waltham, MA, USA, CAT# 31985-062).

We transfected 70% confluent MG87.TRKA, MG87.TRKB, and HEK293T cell lines using Lipofectamine 2000 (Thermo Fischer Scientific). MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001) was used to transfect control cells. HEK293T were transfected with GFP-tagged full-length TRKB plasmid (HP220GFP-TRKB; Haapasalo et al., 2001 (link)) or TRKB carrying Y433F/R427A mutation (Cannarozzo et al., 2020 ).

To create the NM_001080516.1(GRXCR2):c.251delC variant, the pCMV6‐GRXCR2‐WT (wild type) plasmid (Myc‐DDK‐tagged) (OriGene—RC213752) was modified as follows. Site‐directed mutagenesis (SDM) was performed using an adapted protocol supplied by the Stratagene QuikChange system, and the primer pairs used were 5′‐ACTGCTCAGAGATCAGTGTGTTTAGAGAGGG‐3′ and 5′‐CCCTCTCTAAACACACTGATCTCTGAGCAGT‐3′. Successful introduction of the mutation was confirmed by automated BigDye Terminator Sanger sequencing (Applied Biosystems) as described above. The pCMV‐GRXCR2‐WT and pCMV‐GRXCR2‐MT (mutant) vectors were generated by amplifying the open reading frames (ORFs) from the pCMV6‐GRXCR2 plasmid by PCR using a forward primer harbouring a HindIII site, (5′‐GCCGCCAAGCTTCCATGGAGG‐3′) and a reverse primer harbouring a BamHI site (5′‐CCGCGTGGATCCTTGATTGCA‐3′), via sub‐cloning into the pGEM^®‐T Easy vector (Promega). Cloning was confirmed through direct Sanger sequencing.

First, cells were plated in a 6-cm culture dish. The plasmid for human IRAK2 (Myc-DDK-tagged) ectopic expression was purchased from Origene (Rockville, MD). We transfected pCMV6-IRAK2 plasmid into OSCC cells by using Lipofectamine 2000^® (Invitrogen, Carlsbad, CA) and Opti-MEM medium, according to the manufacturer’s protocols. Cells were finally selected for stable clones by using the medium that contained 400μg/ml Geneticin (G418, Invitrogen).