Universal primers

Chemicals including Minimum Essential Medium Eagle (MEM), Roswell Park Memorial Institute Medium (RPMI), penicillin, ampicillin, streptomycin, Fetal Bovine Serum (FBS), O-Nitrophenyl-β-D-galactopyranoside (ONPG), p-Nitrophenyl phosphate disodium salt hexahydrate (PNPP), Histidine, De Man Rogosa and Sharpe (MRS) media, Glycerol, MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide were purchased from Hi-media, Mumbai, India. 4-Nitroquinoline N-oxide (4-NQO), Hexadecane, N,N-Dimethyl dihydrazine dihydrochloride (DMH), Dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (Merck) India. Universal primers (UNI 27F-5′ AGAGTTTGATCCTGGCTGAG 3′, UNI 1492R-5′ GGTTACCTTGTTACGACTT 3′) were procured from Eurofins, India.

The oligo painting probe of S. latifolia, prepared for X chromosome, was designed using Chorus software as previously described by Han et al. (2015) (link). Briefly, oligo sequences (45 nt; >75% similarity) specific to X chromosome, based on the S. latifolia female genome (PRJNA289891; Papadopulos et al., 2015 (link)), were selected throughout the X chromosome scaffolds anchored using an X genetic map. Repetitive sequences were discriminated and removed during oligo painting probe design by Chorus pipeline (Han et al., 2015 (link)). A total of 12 988 oligo sequences were selected to cover X-linked scaffolds. The oligo sequences were synthesized de novo as myTags 20K Immortal library by Arbor Biosciences (Ann Arbor, MI, United States; TATAA Biocenter, Göteborg, Sweden). Labeling and detection of the oligo painting probe followed the published protocol of Han et al. (2015) (link). For labeling of oligo-RNA products, we used universal primers (Eurofins Genomics, Ebersberg, Germany) conjugated with the Cy3 (5′–Cy3–CGTGGTCGCGTCTCA–3′) or primers conjugated with the digoxigenin (5′–DIG CGTGGTCGCGTCTCA–3′), similarly as (Šimoníková et al., 2019 (link)). Digoxigenin was detected by FITC conjugated anti-DIG antibody (Roche Life Sciences).
The number of oligo sequences per scaffold, scaffold length, position on genetic map and scaffold ID are included in Supplementary Table S2.