Prl cmv renilla

pGL3UC vector constructs kindly was provided by V.N. Kim (School of Biological Sciences, Seoul National University, Korea).⁴⁹ (link) A DNA fragment of human Bcl-w 3′ UTR containing the putative miR-340-5p binding site (88 bp) was constructed and cloned into pGL3UC. The nucleotide sequences of primers for the amplification of the Bcl-w 3′ UTRs were 5′- AAATGCTCTAGAGCCTATATTCCTGTATTTTTATTTAATAATTTATAAA-3′ (forward) and 5′-ACACGGAATTCCAAAAATAAAAGTCAAATGAACTTGGTATTTATAAATT-3′ (reverse), and the Sox2 3′ UTRs were 5′-AAAAGCTCTAGAGCGGGCAAAAGTTTTAGACT GTACTAAATTTTATAAC-3′ (forward) and 5′-CCTGGGAATTCCCATGGCCATTTTTGCT TTTAACAGTAAGTTATAAAAT-3′ (reverse), which contained the binding site of miR-340-5p (TTTATA). The vector of mutant type is constructed out of “AATA” that have site-directed mutagenesis of the Bcl-w and Sox2 3′ UTR for binding of miR-340-5p. Then pGL3UC vector were cut by XbaI and EcoRI restriction enzymes, and fragment of PCR product was ligated into pGL3UC vector.
U251 cells were transfected with reporter plasmid containing Bcl-w or Sox2 (200 ng), pRL-CMV-Renilla (Promega, Madison, WI, USA) plasmid (1 ng), and miR-340-5p using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) in 24-well plates. Luciferase reporter system (Promega) was performed according to manufacturer’s protocol. Renilla luciferase activity was used as normalization.