RNeasy serum/plasma midi kit (Qiagen, Hilden, Germany) was used for exosome RNA isolation. During RNA purification, cel-miR-39 spike-in control (Qiagen, Hilden, Germany) was added according to the manufacturer’s recommendation. The RNA isolated from the exosomes was transformed to cDNA, as described below.
Cel mir 39 spike in control
Manufactured by Qiagen
Sourced in Germany
The Cel-miR-39 spike-in control is a synthetic microRNA used as an internal control for RNA isolation and RT-qPCR analysis. It is designed to monitor the efficiency of the RNA isolation and reverse transcription steps during microRNA detection workflows.
Automatically generated - may contain errors
Lab products found in correlation
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol ls, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rnu48, by Thermo Fisher Scientific (1 mentions)
Taqman microrna expression assay, by Thermo Fisher Scientific (1 mentions)
Exorneasy serum plasma midi kit, by Qiagen (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Mirvana paris kit, by Thermo Fisher Scientific (1 mentions)
7 protocols using cel mir 39 spike in control
1
Exosomal RNA Isolation Protocol
2
Trizol-based RNA Extraction from PPPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIZOL LS (Life Technologies) according to the manufacturer’s instructions with some slight changes. Upon thawing of the PPPs in TRIZOL LS (Life Technologies) 3 µl of the cel-miR-39 spike in control (Qiagen) was added. The stock cel-miR-39 solution was diluted with dH2O (Life Technologies), to form a working solution of 1.6 × 108 copies/ μl, according to manufacturer’s instructions. All other RNA extraction steps were performed according to manufacturer’s instructions.
3
Quantifying miRNA Levels in Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To normalize miRNA content in EVs and body fluids, cel‐miR‐39 spike‐in control (Qiagen) was added to Trizol™ reagent during miRNA isolation. RT‐qPCR of miRNA was performed by using a Taqman® MicroRNA Reverse Transcription kit (Applied Biosystems) and sequence‐specific stem‐loop primers for hsa‐miR‐302a‐3p, hsa‐miR‐302c‐3p, hsa‐miR‐1233‐3p, hsa‐miR‐210‐3p, cel‐miR‐39‐3p, and RNU‐48 (Applied Biosystems). Reactions were performed in a StepOne Plus™ Real‐Time PCR system with 1X Master Mix and 1X probes (TaqMan® microRNA Expression Assay, Applied Biosystems). Relative levels of miRNAs in EVs were calculated by using the comparative CT method (2‐∆∆CT) and the cel‐miR‐39 spike‐in control for normalization. RNU‐48 was used as an endogenous control for normalization of cellular miRNA levels. Absolute copy numbers of miRNAs in Figure 4b and Figure 8b , d and e were calculated from standard curves that were generated using miRNA mimetics.
4
Comparative Analysis of miRNA Expression in SEVs and Parental Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-processing of SYBR miRNA qRT-PCR data was completed as previously described [7 ]. We performed a paired analysis to identify miRNAs that were differentially expressed between SEVs and their parental cell lines (i.e. the cells that gave rise to them). MiRNAs were considered enriched if 1) a > 4-fold difference in expression was noted between SEV and cellular fractions following normalization to the global mean of miRNA expression [76 (link)] or 2) a given miRNA was detected in one fraction (either cell or SEV) at a CT below 33 and not detected (at a CT below the threshold of detection: 35) in the matched fraction for all of the cell lines tested.
For follow-up miRNA analysis, cellular miRNA quantification was normalized to the expression of U6. As there is no known endogenous control for SEV miRNAs, follow-up quantification was performed with expression normalized to the cel-miR-39 spike-in control (Qiagen). Analysis of knockdown efficiency of SMPD3 and Rab27A expression was normalized to GAPDH.
For follow-up miRNA analysis, cellular miRNA quantification was normalized to the expression of U6. As there is no known endogenous control for SEV miRNAs, follow-up quantification was performed with expression normalized to the cel-miR-39 spike-in control (Qiagen). Analysis of knockdown efficiency of SMPD3 and Rab27A expression was normalized to GAPDH.
5
EV RNA Isolation from Plasma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
600 µL of cell supernatants and rat plasma were centrifuged (10,000 × g for 30 min at 4 °C) to remove cell debris, and the supernatant was recovered. For RNA isolation of EVs the exoRNeasy serum/plasma midi kit (Qiagen; Hilden, Germany) was used. During the RNA purification step, the same amount of cel-miR-39 spike-in control was added (Qiagen; Hilden, Germany) according to the provider recommendations and previous publication (Enderle et al., 2015 (link)). The RNA isolated from EVs was immediately converted to cDNA, as described below.
6
EV RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
500 μL of plasma was processed for the isolation of RNA using the exoRNeasy serum/plasma midi kit. During the RNA purification step the same amount mentioned above of cel-miR-39 spike in control was added (QIagen) according to the provider recommendations and previous publication [17 (link)]. Extracted RNA isolated from EVs was immediately converted to cDNA as described below.
7
Quantification of Serum miR-223 by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from serum using a miRVana PARIS Kit (Ambion). RNA concentration was determined with a NanoDrop ND‐1000 spectrophotometer (NanoDrop Technologies). About 1 μg (10 µL) RNA was used in reverse transcription. Reverse transcription was performed with the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). PCR reaction for quantification of serum miR‐223 was carried out in triplicate using the SYBR Green PCR Master Mix (Applied Biosystems) as described by the manufacturer. The primers for real‐time PCR were designed as follows: miR‐223 F: 5′‐ GCGTGTATTTGACAAGCTGAG TT ‐3′; miR‐223 R: 5′‐ GTGTCAGTTTGTCAAATACCC CA ‐3′ (Invitrogen). The ABI Prism 7900 HT Sequence detection system (Applied Biosystems) was used to perform real‐time PCR reactions. During the RNA purification step, the same amount mentioned above of cel‐miR‐39 spike‐in control was added (Qiagen) according to the provider recommendations and previous publication.19 The relative levels of miR‐223 expression in serum were normalized against cel‐miR‐39 using the 2−ΔΔCt method. The primer sequences are listed in Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!