The largest database of trusted experimental protocols

Pgl4.1 firefly luciferase reporter vector

Manufactured by Promega

The PGL4.1 firefly luciferase reporter vector is a plasmid that contains the firefly luciferase gene, which can be used as a reporter for gene expression studies. The luciferase gene is under the control of a promoter, allowing for the measurement of promoter activity in cells.

Automatically generated - may contain errors

Lab products found in correlation

2 protocols using pgl4.1 firefly luciferase reporter vector

1

Generating Mutant SIRT1 Promoter Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid containing the human SIRT1 promoter was kindly provided by K. Irani, University of Pittsburgh (Pittsburgh, PA). This plasmid consists of a fragment of the human SIRT1 promoter (–1266 to +137 relative to transcription start site) cloned into the pGL4.1 firefly luciferase reporter vector (Promega, Madison, WI; Yamamori et al., 2010 (link)). The human SIRT1 promoter carrying the mutation at nCaRE-B sequences was generated with a Site-Directed Mutagenesis Kit (Stratagene, Santa Clara, CA), using the primers SIRT1-B mut, forward, 5′-TCATCTAGG­TTTTATTTATATATTTTTTTGCTAAGG­AGCGTCGCTCTTGCTGC­C­CAGGCTGGTGTG-3′, and SIRT1-B mut, reverse, 5′-CACACCAGCC­TGGGC­AGCAAGAGCGACGCTCCTTAGCAAAAAAATATATAAATAAAACCTAGATGA-3′.
Expression and purification of recombinant proteins from E. coli were performed as previously described (Vascotto et al., 2009b (link); Fantini et al., 2010 (link)).
+ Open protocol
+ Expand
2

POLD1 Promoter Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The plasmids were purchased from SyngenTech. In brief, we cloned a 2000‐bp region of the POLD1 promoter (WT) or binding sites being mutated promoter sequence and inserted the cloned fragment into the pGL4.1 firefly luciferase reporter vector (Promega). An empty pGL4.1‐promoter vector was transferred as a systemic control. HEK‐293 cells were seeded into wells of a 24‐well plate and transiently transfected with various plasmids when cells were at 70% confluence. After 2 days, the luciferase activities were evaluated using the Lucifer Reporter Assay (Beyotime Biotechnology) and normalized to Renilla luciferase activity.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!