Total RNA was isolated with TransZol UP reagent (TransGen) and treated with Ambion DNA Removal Kit. First strand cDNA was synthesized with oligo (dT)18 from 1 μg RNA with M-MLV reverse transcriptase (Takara). The qRT-PCR experiments were performed on a BioRad real-time PCR detection system (iQ5) using SYBR Green reagent (Toyobo). The PCR cycle number was determined for each primer pair to the point at which amplification was in the linear phase.
Dna removal kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The DNA removal kit is a lab equipment product designed to remove DNA from samples. It serves the core function of eliminating DNA contamination from various types of biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Tri reagent, by Thermo Fisher Scientific (4 mentions)
Tri reagent, by Merck Group (3 mentions)
Transzol up reagent, by Transgene (2 mentions)
M mlv reverse transcriptase, by Takara Bio (2 mentions)
Cells to cdna kit, by Thermo Fisher Scientific (2 mentions)
Special 18s rrna modified primers, by Thermo Fisher Scientific (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions)
Abi prism 7500 sequence detector, by Thermo Fisher Scientific (2 mentions)
Rneasy mini column, by Qiagen (2 mentions)
Gapdh, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sybr green reagent, by Toyobo (1 mentions)
Quantity one software version 4, by Bio-Rad (1 mentions)
Ham s f12 medium, by GE Healthcare (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Tri reagent solution, by Thermo Fisher Scientific (1 mentions)
Squalene, by Merck Group (1 mentions)
Turbo dnase treatment, by Thermo Fisher Scientific (1 mentions)
23 protocols using dna removal kit
1
Quantitative RT-PCR Experimental Protocol
2
Evaluating siRNA Knockdown Efficiency in HeLa Cells
3
Liver RNA Isolation and Quality Assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from each liver was isolated using Tri reagent (Sigma). DNA contaminants were removed by TURBO DNAse treatment using the DNA removal kit from AMBION (Austin, TX, USA). RNA was quantified by absorbance at 260 and 280 nm. The A260/280 ratio did not vary significantly among groups. The integrity of the 28S and 18S ribosomal RNAs was verified by 1% agarose gel electrophoresis of 500 ng of total RNA. Ethidium-bromide stained gels were exposed to UV light and images were captured (BioRad, Madrid, SpA-In). Intensity of bands for each condition was calculated using Quantity One® software version 4.5.0 (BioRad). The 28S/18S ratio did not differ among groups. RNA integrity number (RIN) from samples was obtained by RNA nano kit using an Agilent 2100 Bioanalyzer. RIN values were not significantly different among tested groups.
4
Murine Hepatic Cell Line Squalene and Sterol Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hepatic cell line of murine origin was grown in a humidified atmosphere of 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s minimum essential medium (DMEM) (Thermo Fisher Scientific, Waltham, MA, USA): F12-Ham’s medium (GE Healthcare Life Science, South Logan, UT, USA) enriched with fetal bovine serum and insulin/transferrin/selenium. When cells reached a confluence of 90–100%, medium was removed, cells were washed twice with phosphate buffered saline followed by addition of medium free of fetal bovine serum, insulin, transferrin and selenium. Cells were then incubated for 6 h with 200 µM squalene (Sigma-Merck, Darmstadt, Germany) or with 200 nM lanosterol, dihydrolanosterol, zymostenol or desmosterol (Avanti Polar lipids, Alabaster, AL, USA). Each condition was tested in six replicates. Media were removed, cells were washed twice with phosphate buffered saline then collected and total RNA was extracted using Tri-reagent solution (Ambion, Austin, TX, USA). DNA contaminants were removed by TURBO DNAse treatment using DNA removal kit (Ambion, Austin, TX, USA). squalene and sterol effects were investigated at mRNA level by RT-qPCR assays.
5
Isolation of RNA and DNA from Suspension CHO Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO cells selected for RNA and DNA isolation were grown in suspension in CD-CHO medium (LifeTechnologies) to a viable density of 1–2×106 cells/mL. All cultures were grown at 37°C in shake flasks, in an environment controlled shaking incubator maintaining 6% CO2, and 80% humidity (Multitron HT, Infors). Culture volumes containing 5×106 cells were subjected to centrifugation, medium was discarded, and pellets frozen at -80°C. Total RNA (tRNA, mRNA and rRNA) was isolated from frozen cell pellets consisting of 5×106 CHO cells using the mirVANA miRNA Isolation kit (Ambion) following the manufacturer’s recommendations. Contaminating DNA was removed from the purified RNA samples using a DNA removal kit (Ambion). Genomic DNA (gDNA) was isolated from frozen cell pellets using the AllPrep DNA/RNA Mini Kit (Qiagen). For each gDNA isolation 5×106 cells were lysed in 600μl lysis buffer and purified following the manufacturer’s instructions.
6
Quantifying Ag43 Expression in E. coli
7
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analysis was performed by real‐time polymerase chain reaction. Total RNA was extracted from whole left atrium by homogenizing in RLT buffer and by using RNeasy Mini columns (Qiagen). Genomic DNA impurities were removed by DNase treatment (DNA Removal Kit, Ambion), and cDNA was synthesized by reverse transcription (Life Science Technologies). Quantitative real‐time polymerase chain reaction was performed using Taqman primers on an ABI Prism 7500 Sequence Detector (Applied Biosystems) and c(t) values obtained by using a respective software (SDS version 1.9). C(t) values were normalized to corresponding GAPDH controls. The ΔCt was used for statistical analysis and 2−ΔΔCt standardized to the control group was used for data presentation. Probes used to amplify the transcripts were as follows (purchased by Applied Biosystems): GAPDH (Rn99999916_s1), OPN (Spp1) (Rn00681031_m1), TGF‐β1 (Rn00572010_m1), Col1a1 (Rn01463848_m1), connective tissue growth factor (Rn01537279_g1), and sarcoplasmic reticulum calcium ATPase type 2A (ATP2a2 Rn00568762_m1).
8
Gene Expression Analysis of Left Atrial Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analysis was performed in left atrial tissue by real-time polymerase chain reaction. Total RNA was extracted from whole left atrium by homogenizing in RLT buffer and by using RNeasy Mini columns (Qiagen). Genomic DNA impurities were removed by DNase treatment (DNA Removal Kit, Ambion), and cDNA was synthesized by reverse transcription (Life Science Technologies). Quantitative real-time polymerase chain reaction was performed using Taqman primers on an ABI Prism 7500 Sequence Detector (Applied Biosystems) and c(t) values obtained by using a respective software (SDS version 1.9). C(t) values were normalized to corresponding GAPDH controls. The deltaCt was used for statistical analysis and 2 deltaCt standardized to the control group was used for data presentation. Probes used to amplify the transcripts were as follows (purchased by Applied Biosystems): GAPDH (Rn99999916_s1), Transforming growth factor beta 1 (TGF-b1, Rn00572010_m1), collagen 1a1 (Col1a1, Rn01463848_m1), connective tissue growth factor (CTGF, Rn01537279_g1).
9
Quantifying M. truncatula Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from M. truncatula hairy roots 4 weeks post transformation using the TransZol UP reagent (TransGen). RNA samples were treated with Ambion DNA Removal Kit and absence of DNA contamination was confirmed by PCR. First strand cDNA was synthesized with oligo (dT) 18 from 1 mg RNA with M-MLV reverse transcriptase (Takara). Real-time RT-PCR analysis was carried out in a CFX96 Real-Time PCR machine (BioRad) using 1 μl of diluted (1:20) cDNA in a total reaction volume of 10 μl containing SYBR Green Master Mix (Takara) and primers. Thermal cycling conditions were: 95°C 1 min, 45 cycles of 95°C 10 s, 60°C 30 s, followed by dissociation curve analysis. Relative expression was normalized to the reference gene ubiquitin. Mean and standard error values were calculated from three biological replicates. More than ten plants were used for RNA extraction.
10
Evaluating siRNA Knockdown Efficiency in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the efficiency of siRNA knockdown in HeLa cells, we performed real-time PCR analyses. HeLa cells were transfected with the indicated siRNA or scrRNA control. cDNA was obtained using a Cells-to-cDNA kit (Ambion). Genomic DNA was removed using a DNA removal kit (Ambion). cDNA was obtained using the oligo dT primer. Real-time PCR was performed using a Fast SYBR Green master mix (Applied Biosystems). Primer sequences for the expression analysis were as follows: KCNA1, TTCTTCGACCGCAACCGGCC and AGCTATCTCGGTGCCCAGGGT; RPL14, AGGTTGGCCGGGTGGCCTAT and AGGCGCTGCTTTCTGGCCTG; SBP2, GCAGGCAGAGCTGTCAGGGC and TGGGCTCTCCCACCAGCTCC. Special 18S rRNA modified primers (Ambion) were used as an internal control for data normalization. We also compared the consequence of downregulation with the individual and pooled DNAJC17 siRNAs, since knockdown of this gene showed the strongest effect on ATP7A levels. These studies revealed that only one individual siRNA (#2) decreased the ATP7A levels similarly to the pool, whereas other individual siRNA (and a combination of three out of four, #1, #3 and #4) had no significant effect on ATP7A levels despite a significant decrease in the mRNA levels for DNAJC17 (confirmed by real-time PCR). Thus, the effect of DNAJC17 knockdown on ATP7A may be indirect or confounded by other unknown factors.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!