Neb q5 site directed mutagenesis kit

Manufactured by New England Biolabs

Sourced in United States

The NEB Q5 Site-Directed Mutagenesis Kit is a tool used to introduce specific mutations into DNA sequences. It provides a rapid and efficient method for generating site-directed mutations in plasmid DNA.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Q5 site-directed mutagenesis (88 citations) Q5 mutagenesis kit (72 citations) Q5 mutagenesis (18 citations) Q5 kit (13 citations) Site-directed mutagenesis (8 citations) Q5 site Mutagenesis Kit (5 citations) NEB kits (3 citations) NEB-Q5 mutagenesis kit (2 citations)

31 protocols using neb q5 site directed mutagenesis kit

Modifying C. elegans NURF-1 Isoform

Check if the same lab product or an alternative is used in the 5 most similar protocols

All sgRNAs were constructed using NEB Q5 site directed mutagenesis kit (E0554) using primers
5’- [unique sgRNA protospacer sequence] + GTTTTAGAGCTAGAAATAGCAAGT −3’ and
5’- CAAGACATCTCGCAATAGG −3’ to modify a vector backbone containing a subclone of pDD163 containing the U6 promoter to drive sgRNAs in germline¹.
To create the pCFJ151 - Pnurf-1.d::nurf-1.d-sl2-GFP plasmid, a nurf-1.d cDNA was isolated from reverse transcribed RNA using primers containing NheI restriction sites. This PCR product was then digested and ligated to a pSM vector. A 2890 bp long promoter region immediately upstream of the nurf-1.d isoform was amplified with a forward primer including FseI and a reverse primer including AscI restriction sites. This PCR product was then digested and ligated into the vector constructed in step 1. Third, an SL2-GFP sequence from was cut and ligated into the new vector using KpnI and SpeI restriction sites. Finally, this entire sequence containing the promoter, cDNA and sl2::GFP sequence was inserted into the pCFJ151 vector using NEB Q5 site directed mutagenesis kit.

Xu W., Long L., Zhao Y., Stevens L., Felipe I., Munoz J., Ellis R.E, & McGrath P.T. (2019). Evolution of Yin and Yang isoforms of a chromatin remodeling subunit precedes the creation of two genes. eLife, 8, e48119.

+ Open protocol

+ Expand

Cloning and Mutagenesis of GC-Rich Enhancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

forward, 5’-TTTCTCTATCGATAGGTTCGGCCCCTCCCCAGGCCCCTCCCCGCCCCCCCCCCCCCCCGG-3’
reverse, 5’- TCGAGCCCGGGCTAGGGCCTCCACCCTCCCTCC-3’.
The amplification of the putative enhancer containing rs9932282 proved challenging given the high GC rich content. We changed the primer design to incorporate as much of the GC rich region as we could into one oligo, resulting in a 60 bp oligo.
Following infusion cloning, the recombinant DNA was transformed into NEB Stable E. coli cells (NEB) under standard transformation conditions. Colonies were selected and plasmid DNA was extracted using The PureLink^™ Quick Plasmid Miniprep Kit (Thermofisher Scientific) and sent for Sanger sequencing to identify the integrity and quality of the inserted enhancer fragment. Vectors with the correct sequence were purified using the PureLink Expi Endotoxin-Free Maxi Plasmid Purification Kit (Thermofisher Scientific) and the sequence was confirmed again using Sanger sequencing. Once the putative enhancers containing all three SNPs were successfully cloned into the pGL3 vector, site directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and the NEB Q5 Site Directed Mutagenesis kit (NEB) was performed to introduce the risk allele for each SNP. The primers used for mutagenesis are as follows:

Sonti S., Littleton S.H., Pahl M.C., Zimmerman A.J., Chesi A., Palermo J., Lasconi C., Brown E.B., Pippin J.A., Wells A.D., Doldur-Balli F., Pack A.I., Gehrman P.R., Keene A.C, & Grant S.F. (2023). Perturbation of the insomnia WDR90 GWAS locus pinpoints rs3752495 as a causal variant influencing distal expression of neighboring gene, PIG-Q. bioRxiv.

+ Open protocol

+ Expand

Generating Chlamydia Strains Expressing Tagged Proteins

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CTL0184 (inaC) ORF and 250 b.p of upstream sequence was amplified by PCR from cell extracts derived from Vero cells infected with L2 434 Bu and cloned into the p2TK2_SW2 vector (Agaisse and Derré., 2013 (link)). A NEB Q5^®-Site Directed Mutagenesis Kit (New England Biolabs; E0554S) was used to insert a 3X FLAG epitope sequence at the C-terminus (stop codon removed) of the CTL0184 ORF to generate the p2TK2_SW2-InaC-3XFlag plasmid.
pBOMB4-MCI based plasmids and p2TK2_SW2-InaC-3X Flag plasmids were transformed into corresponding Chlamydia strains, and transformants were selected with 10 U/mL Penicillin G and plaque purified as previously described (Kędzior and Bastidas., 2019 (link)). All primer sequences and plasmids generated in this study are listed in S. Table 10 and Key Resources Table.

Bastidas R.J., Kędzior M., Davidson R.K., Walsh S.C., Dolat L., Sixt B.S., Pruneda J.N., Coers J, & Valdivia R.H. (2023). The acetylase activity of Cdu1 regulates bacterial exit from infected cells by protecting Chlamydia effectors from degradation. bioRxiv.

+ Open protocol

+ Expand

Identification of IRF3 Binding Sites in GLI3 Intron

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 1641bp region of the GLI3 intron 1–2 regulatory region containing candidate IRF3 binding sites was PCR amplified with the following primers: 5′-ggtacctgagctcgctagcctcgagGTCGAAGGGAACAATTATAG-3′ and 5′-gaggccagatcttgatatcctcgagCCATCTCTTTTCTGAGATTATC-3′ from MM6 genomic DNA and cloned into the pGL4.10 luciferase plasmid digested with XhoI using the NEB HiFi DNA Assembly kit (NEB E2621S). The resulting plasmid pGL4-GLI3-WT was verified by sequencing. Three independent IRF3 binding sites within the GLI3 promoter (aaaagaaa, aaaagaaa, aaccgaaa) were individually deleted using the NEB Q5 Site-Directed Mutagenesis Kit following the manufacturer’s instructions (NEB E0554S). pGL4-GLI3-Mut1 (lacking binding site 1; BS1) was generated using the primers 5′-ATGTATGTAGCTAAACCAG-3′ and 5′-TATTCAGTGTTTCGTTGAAAAC-3′, pGL4-GLI3-Mut2 (lacking BS2) was generated with the primers 5′-CAAAACCGAAAAAACAAAAAC-3′ and 5′-GAGACAGAGTCTCACTCTG-3′, and pGL4-GLI3-Mut3 (lacking BS3) was generated with the primers 5′-AAACAAAAACAAACAAACAAAAAAAC-3′ and 5′-TTGTTTCTTTTGAGACAGAG-3′. The resulting plasmids were verified by sequencing.

Matissek S.J., Karbalivand M., Han W., Boutilier A., Yzar-Garcia E., Kehoe L.L., Gardner D.S., Hage A., Fleck K., Jeffers V., Rajsbaum R, & Elsawa S.F. (2022). A novel mechanism of regulation of the oncogenic transcription factor GLI3 by toll-like receptor signaling. Oncotarget, 13, 944-959.

+ Open protocol

+ Expand

Myoglobin-mCherry Fusion Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Myo-mCherry plasmid preparation was described previously ^{5 (link)} and this plasmid, here named Myo-mCherry 2GS, was used as the base for preparing the constructs reported in this work. Reduction of the linker to one residue. Glycine, (Myo-mCherry 1G) was performed by deletion of one codon through the NEB Q5 Site-Directed mutagenesis kit (New England BioLabs Inc.). Insertion of residues for the longer linkers (4GS, 6GS), as well as mutation of Histidine 64 into Glutamine was performed by using the Agilent QuickChange XLII site-directed mutagenesis kit (Agilent Technologies). The linker residues between myoglobin and mCherry are GSGS and GSGGSG for 4GS and 6GS, respectively. The final constructs were all confirmed by full sequencing.

Andreoni A., Penjweini R., Roarke B., Strub M.P., Sackett D.L, & Knutson J.R. (2019). Genetically encoded FRET probes for direct mapping and quantification of intracellular oxygenation level via fluorescence lifetime imaging. Proceedings of SPIE--the International Society for Optical Engineering, 10882, 108820O.

+ Open protocol

+ Expand

Bacterial Toxin Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleotide sequences of pLTB (Uniprot accession number P32890) and hLTB (Uniprot accession number P0CK94) were ordered from the GeneArt gene synthesis service (Thermo Fisher Scientific, Waltham, MA, USA), codon-optimized for expression in E. coli. The genes were subcloned into vector pET21b(+) (Novagen, Merck, Darmstadt, Germany). Single-site mutations were introduced using the Quikchange kit (Agilent Technologies, Santa Clara, CA, USA) or the NEB Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). The resulting plasmids were verified by DNA sequencing, and the purified proteins were later checked for proper folding using circular dichroism. The protein sequences for the proteins used in this study were as follows: pLTB: APQTITELCS EYRNTQIYTI NDKILSYTES MAGKREMVII TFKSGETFQV EVPGSQHIDS QKKAIERMKD TLRITYLTET KIDKLCVWNN KTPNSIAAIS MKN; hLTB: APQSITELCS EYHNTQIYTI NDKILSYTES MAGKREMVII TFKSGATFQV EVPGSQHIDS QKKAIERMKD TLRITYLTET KIDKLCVWNN KTPNSIAAIS MEN; and CTB (El Tor biotype): TPQNITDLCA EYHNTQIYTL NDKIFSYTES LAGKREMAII TFKNGAIFQV EVPGSQHIDS QKKAIERMKD TLRIAYLTEA KVEKLCVWNN KTPHAIAAIS MAN.

Heggelund J.E., Heim J.B., Bajc G., Hodnik V., Anderluh G, & Krengel U. (2019). Specificity of Escherichia coli Heat-Labile Enterotoxin Investigated by Single-Site Mutagenesis and Crystallography. International Journal of Molecular Sciences, 20(3), 703.

+ Open protocol

+ Expand

Generating HIV-1 Virions in HEK293T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic kidney (HEK) 293T CRL-3216 cells were purchased from American Type Culture Collection. All cells are regularly tested and are mycoplasma free. HEK293T and HeLa cell lines were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum (FBS), 2 mM l-glutamine, penicillin (100 U/ml), and streptomycin (100 mg/ml; Gibco) at 37°C with 5% CO₂. The MT4 and SupT1 T cell lines were maintained in RPMI 1640 with l-glutamine (Corning) and supplemented with 10% FBS (GenClone), penicillin (100 U/ml), and streptomycin (100 mg/ml). Replication-deficient vesicular stomatitis virus glycoprotein (VSV-G)–pseudo-typed HIV-1 virions were produced in HEK293T cells using the packaging plasmid pMDG2, which encodes VSV-G envelope (Addgene plasmid no. 12259), pNL4-3–derived pCRV GagPol (HIV-1 clade B) (25 (link)), and pCSGW (26 (link)) as described previously (27 (link)). Mutagenesis of CA was performed using the QuickChange method (Stratagene) against pCRV GagPol, and primer sequences are given in table S1. The HIV-1 clade B infectious molecular clone pNL4-3 was used for all passage and virus release experiments. Mutant constructs were generated with the New England Biolabs (NEB) Q5 site directed mutagenesis kit (NEB, E0554), and primers (see table S1) were designed using the NEBaseChanger online tool.

Mallery D.L., Kleinpeter A.B., Renner N., Faysal K.M., Novikova M., Kiss L., Wilson M.S., Ahsan B., Ke Z., Briggs J.A., Saiardi A., Böcking T., Freed E.O, & James L.C. (2021). A stable immature lattice packages IP6 for HIV capsid maturation. Science Advances, 7(11), eabe4716.

+ Open protocol

+ Expand

Purification of Mutant TRF1 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutagenesis primers were designed with NEBaseChanger. pACEBac1vector with TRF1 mutants was prepared with the NEB Q5 Site-Directed Mutagenesis Kit (New England Biolabs, catalog no. E0554). Constructs were transformed to chemically competent cells and grown at 37°C overnight. The presence of the mutations was confirmed by DNA sequencing. Recombinant baculoviruses were generated by Bac-to-Bac Baculovirus Expression System (Invitrogen) using EmBacY cells (Geneva Biotech). For the expression of wild-type and mutant MBP-tagged TRF1_core proteins, three individual viruses that contains TRF1, TIN2, and TPP1, respectively, were used together to infect Sf9 cells. Purification of MBP-tagged TRF1_core proteins followed the similar procedure as untagged protein purification. Proteins were first purified using dextrin Sepharose resin and eluted using wash buffer containing 50 mM maltose. Proteins were then diluted and further purified using a 1-ml HiTrap heparin HP column (Cytiva, catalog no. 17040601). Peak fractions from linear elution gradient were pooled, concentrated, snap-frozen in liquid nitrogen, and stored at −70°C until use.

Hu H., van Roon A.M., Ghanim G.E., Ahsan B., Oluwole A.O., Peak-Chew S.Y., Robinson C.V, & Nguyen T.H. (2023). Structural basis of telomeric nucleosome recognition by shelterin factor TRF1. Science Advances, 9(34), eadi4148.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of PykA Enzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols

Template DNA of p2CT-BsuPykA plasmid containing the gene for wild-type PykA was used to generate the pykA mutants using site directed mutagenesis (NEB Q5 site directed mutagenesis kit) and the CAT construct. The primers listed in Table 1 were purchased from Sigma. Gene overexpression and purification of all mutated proteins and the CAT domain were carried out as described for the wild-type PykA protein.

Holland A., Pitoulias M., Soultanas P, & Janniere L. (2023). The Replicative DnaE Polymerase of Bacillus subtilis Recruits the Glycolytic Pyruvate Kinase (PykA) When Bound to Primed DNA Templates. Life, 13(4), 965.

+ Open protocol

+ Expand

HEK293T and THP-1 Cell Culture Protocols

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic kidney (HEK) 293T CRL‐3216 cells were purchased from American Type Culture Collection. All cells are mycoplasma free and they are regularly tested. HEK293T was cultured in Dulbecco's modified Eagle's medium with 10% foetal bovine serum (FBS), 2 mM L‐glutamine, penicillin (100 U/ml) and streptomycin (100 mg/ml; Gibco) at 37°C with 5% CO₂.
THP‐1 cells were maintained in RPMI (Gibco) supplemented with 10% FBS and Pen/Strep. THP‐1‐IFIT1 cells that had been modified to express Gaussia luciferase under the control of the IFIT1 promoter were described previously (Mankan et al, 2014 (link)). THP‐1 Dual Control and STING KO and MAVS KO cells were previously described (Sumner et al, 2020 (link)). Jurkat and SupT1 T‐cell lines and PBMCs were maintained in RPMI 1640 with L‐glutamine (Corning) and supplemented with 10% FBS (GenClone), penicillin (100 U/ml) and streptomycin (100 mg/ml). STING inhibitor H151 was obtained from Invitrogen.
Mutant construct D185E was generated with the New England Biolabs (NEB) Q5 site‐directed mutagenesis kit (NEB, E0554) against pCRV GagPol WT and mutants (K158A, K158A/T8I, T8I; Mallery et al, 2021 ) using primers designed using the NEBaseChanger online tool.

Papa G., Albecka A., Mallery D., Vaysburd M., Renner N, & James L.C. (2023). IP6‐stabilised HIV capsids evade cGAS/STING‐mediated host immune sensing. EMBO Reports, 24(5), e56275.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!