Top green qpcr supermix kit

To validate the accuracy of the RNA-seq data, we randomly selected 20 DEGs for qRT-PCR analysis. A total of six RNA samples from each group were reverse transcribed to complementary DNA using a Prime Script RT Master Mix Kit with DNase I (TaKaRa, Dalian, China) following the manufacturer’s instructions. Primers were designed using primer premier 5.0 software and were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (Table S2). Then, qRT-PCR was performed in triplicate reactions in 96 well plates using the Top Green qPCR SuperMix Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions using the following cycling conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, and 55 °C for 42 s, then 72 °C for 10 s, followed by 72 °C for 5 min. A melting curve was then produced using an ABI QuantStudio 7 Flex Sequence Detection System (Applied Biosystems Co. Ltd., Foster City, CA, USA). The fold expression change of DEGs was calculated using the 2^−ΔΔCt method [32 (link)]. The mRNA levels of the DEGs were normalized against an endogenous reference gene, glyceraldehyde-3-phosphate dehydrogenase (Gapdh).

The quality of total RNA was confirmed by Nanodrop 2000, followed by extraction from treated cells using TRIzol (Invitrogen, USA). Total RNA (500 ng) was reverse transcribed with a One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGen Biotech, China) to synthesize cDNA (20 μL), and then, qRT-PCR was conducted to quantify gene expression using a Top Green qPCR SuperMix kit (TransGen Biotech, China). The primer sequences for each gene were designed and validated for specificity. The primer sequences used in qRT-PCR were as follows: CCL20-F (5′-GGAATGGAATTGGACATAGCC-3′) and CCL20-R (5′-CCTCCATGATGTGCAAGTGA-3′); CCR6-F (5′-AATCGCTTGAACCCAGAAGC-3′) and CCR6-R (5′-GAGTCTCGCTTTGTCACC-3′); TFEB-F (5′-TGTTGCTGCATGCGCTC-3′) and TFEB-R (5′-CGGCAGTGCCTGGTACAT-3′); TNF-α-F (5′-CCTCTCTCTAATCAGCCCTCTG-3′) and TNF-α-R (5′- GAGGACCTGGGAGTAGATGAG-3′); IL-6-F (5′-TACATCCTCGACGGCATCTC-3′) and IL-6-R (5′-TTTCAGCCATCTTTGGAAGG-3′); GAPDH-F (5′-GGAGCGAGATCCCTCCAAAAT-3′) and GAPDH-R (5′-GGCTGTTGTCATACTTCTCATGG-3′); and β-actin-F (5′-GCTCCTCCTGAGCGCAAG) and β-actin-R (5′-CATCTGCTGGAAGGTGGACA-3′). The relative expression of genes of interest was calculated and normalized to that of GAPDH or β-actin using the 2-ΔΔCt method.

Real‐time PCR was performed as previously described with modification (Hu et al., 2019). Briefly, the total RNA was isolated from about 20 mg of each tissue sample using the Tissue RNA Kit (R6812, Omega), and reverse‐transcribed into cDNA with the First‐Strand cDNA Synthesis SuperMix Kit (AT301, TransGen). Samples were then stored at −80°C until further analysis. The concentration and purity of the RNA were calculated by a Nanodrop 2000 spectrophotometer (Thermo Fisher). For real‐time PCR, the cDNA was amplified using a Top Green qPCR SuperMix Kit (AQ131, TransGen) on the CFX96 Touch™ Real‐Time System (Bio‐Rad). The following thermal cycling parameters were used: 95°C for 3 min, then 40 cycles of 95°C for 10 s and 60°C for 30 s. Melting curve analysis comprised of the following parameters: 95°C for 10 s, after which the ramp speed was decreased from 1.667°C/s to 0.01667°C/s and data were collected continuously until it reached 95°C where the temperature was held for 30 s, and finally held at 60°C for 15 s. All samples were run in triplicate, whereas non‐template controls were run in duplicate. Primer sequences used were listed in Table 1. The data from real‐time PCR were analysed using the 2^‐ΔΔCt method. The relative expression levels were normalized to the expression level of β‐Actin.

QRT‐PCR was performed with reference to a previous study.
⁴¹ (link) Total RNA was extracted from H9c2 cells by the TransZol Up Plus RNA Kit (ER501‐01; TransGen Biotech).
⁴² (link) Next, the isolated RNA sample concentration was evaluated using a spectrophotometer (Cary 60 UV‐Vis; Agilent), and cDNA was synthesized using RNA as template with the help of a One‐Step RT‐PCR SuperMix kit (AE411‐02; TransGen Biotech). After that, qRT‐PCR reaction solution was prepared by the Top Green qPCR SuperMix kit (AQ131‐01; TransGen Biotech) and supplemented with above cDNA and corresponding primers. Then, the PCR reaction was performed on the qRT‐PCR system (ABI7700; Applied Biosystems) under the following conditions: 1 cycle at 94°C for 30 s, 40 cycles at 94°C for 5 s, 40 cycles at 60°C for 15 s, and 40 cycles at 72°C for 10 s. The results were analyzed by the 2−∆∆Ct method,
⁴³ (link) and primer sequences of TLR4 and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH, the endogenous control) were listed in Table 1.

For qPCR analysis, total RNA was extracted from the serum spheres and serum-free spheres by using TRIzol reagent (Solarbio, Beijing, China) according to the manufacturer’s instructions. Reverse transcription was performed using an EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China). QPCR was performed using a Top Green qPCR SuperMix kit (TransGen Biotech, Beijing, China) in a CFX96 Real‐Time PCR Detection System (Bio‐Rad). The sequences of the primers used are listed in Table 1.Table 1

Nucleotide sequences of primers used for quantitative polymerase chain reaction analysis

Gene name	Forward (5′–3′)	Reverse (5′–3′)
GAPDH	GAAAGCCTGCCGGTGACTAA	GCCCAATACGACCAAATCAGAG
OCT-4	CTCGAGAAGGATGTGGTCCG	TAGTCGCTGCTTGATCGCTT
SOX2	AGGATAAGTACACGCTGCCC	TAACTGTCCATGCGCTGGTT
NANOG	AATGGTGTGACGCAGGGATG	TGCACCAGGTCTGAGTGTTC
ALDH	TGCCGGGAAAAGCAATCTGA	CAACAGCATTGTCCAAGTCGG
CD133	CGGGTGCACGGGATGG	TTCTGTCTGAGGCTGGCTTG
LGR5	AAGCCTTCAATCCCTGCGTC	CAGGCCACTGAAACAGCTTG
CD44	ACACAAATGGCTGGTACGTCT	TGTGGTTGAAATGGTGCTGG
EpCAM	GCTGGCCGTAAACTGCTTTG	ACATTTGGCAGCCAGCTTTG
E-cadherin	TACCCTGGTGGTTCAAGCTG	CAAAATCCAAGCCCGTGGTG
N-cadherin	ATGGGAAATGGAAACTTGATGGC	CAGTTGCTAAACTTCACTGAAAGG

In this work, qRT-PCR was performed on the qRT-PCR system (ABI7700, Applied Biosystems, Carlsbad, CA, USA). The tissue samples and transfected NPCs were harvested prior to the analysis of qRT-PCR. TransZol Up Plus RNA Kit (ER501-01) was purchased from TransGen Biotech (Beijing, China) and employed to extract the total RNA from the collected tissues and cells. The concentration of isolated RNA samples was evaluated using a spectrophotometer (Cary 60 UV-Vis, Agilent, Santa Clara, CA, USA). Next, using RNA as template, the cDNA was synthesized with the help of First-Strand Synthesis System (18091050, Thermo Fisher Scientific, Waltham, MA, USA), and the reaction mix solution for qRT-PCR was prepared by the Top Green qPCR SuperMix kit (AQ131-01, TransGen Biotech, Beijing, China). After the supplementation of cDNA synthesized above and the corresponding primers (Table 1), the qRT-PCR reaction mix solution was detected by the qRT-PCR system. The results in our study were analyzed with 2^−ΔΔct method [25 (link)], and GAPDH or U6 was used as the endogenous control.