Anti h3k27ac

ChIP-PCR and ChIP-seq experiments were performed as previously described (17 (link)). Antibodies for histone modifications (anti-H3K4me, anti-H3K27ac, anti-H3K27me3 and anti-H3K36me3) were obtained from Millipore (Billerica, MA, USA). An anti-Flag M2 antibody (Sigma-Aldrich Corporation, St. Louis, MO, USA) was used in the ChIP experiments involving Flag-BmHP1a.

Chromatin immunoprecipitation (ChIP) experiments were performed as previously described by Bruno et al. (29 (link)) using the following antibodies: anti-AATF/Che-1 (Bethyl), anti-UBF (H-300; Santa Cruz Biotechnology), anti-RPA194 (H-300; Santa Cruz Biotechnology), anti-HDAC1 (Sigma-Aldrich), anti-H3K9me3 (Abcam), anti-H3K27Ac (Millipore) and anti-H4Ac (Millipore). For sequential ChIP experiments (Re-ChIP), immunoprecipitated complexes were eluted in 25 μl 10 mM DTT for 30 min at 37°C. After centrifugation, the supernatant was diluted 10 times in Re-ChIP buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM TRIS pH 8.0) and subjected again to ChIP procedures. Immunoprecipitations with no specific immunoglobulins (Santa Cruz Biotechnology) were performed as negative controls. For quantitative ChIP analysis (ChIP-qRT), 1 μl of purified DNA was used for amplification on a 7500 Fast Real-Time PCR System (Applied Biosystems) using a SYBR Green 2× qPCR Master Mix (Primerdesign). Information on primers used in these experiments is provided in Supplementary Table S3.

Histones were acid extracted from 10T1/2 and CCD-1070Sk cells, resolved by 15% SDS–PAGE, and stained immunochemically with anti-H3 (Abcam), anti-H3S10ph (Santa Cruz Biotechnology,), anti-H3S28ph (Sigma-Aldrich), anti-H3K27ac (Millipore), anti-H3K9ac (Abcam), anti-H3K14ac (Abcam), or H3K4me1 (Abcam) antibodies (Chadee et al., 1999 (link)). The specificity of the antibodies was verified by immunoblot using 2–3 µg of synthetic peptides derived from human histone H3.1 and carrying the following PTMs: H3S10ph (Abcam), H3S28ph (Abcam), H3K27ac (Abcam), H3K9ac (Abcam), H3K9ac/S10ph (Abcam), or H3K27ac/S28ph (EpiCypher, Research Triangle Park, NC). Three biological repeats were performed.

Chromatin immunoprecipitation (ChIP) assays were performed as previously described (37 (link),38 (link)). For ChIP-qPCR, 5 μg chromatin was immunoprecipitated with 1 μg of the indicated anti-CIITA antibody overnight at 4°C. Enrichment was determined using a 5-point genomic DNA standard curve and plotted as percentage of input chromatin or percentage of HLA-DRA enrichment. Standard error of the mean was used to represent experimental variation from three independent biological experiments. All ChIP primers used in this study are listed in Supplemental Table S2. For ChIP-seq, 30 μg chromatin was immunoprecipitated with 5 μg of anti-CIITA antibody ‘B’ generated in our lab (39 (link)), anti-H3K27^ac (Millipore, 07-360), or anti-H3K4^me3 (Millipore, 07-473) antibody overnight at 4°C. For anti-CIITA antibodies from Rockland Immunochemicals Inc. (100-401-249) and Diagenode (C15410062), 10 μg of antibody was prebound to 30 μl of Protein A beads and incubated overnight at 4°C with 30 μg of chromatin. Antibody–chromatin complexes were captured with Protein A beads (Invitrogen), cross-links reversed and DNA purified. Five percent of each chromatin suspension was removed prior to the immunoprecipitation and used as the Input fraction.

ChIP analyses were performed using a Magna ChIP G (Millipore, Bedford, MA) according to the manufacture's instructions. After crosslinking using 1% formaldehyde, cells were sonicated (setting 5, Handy Sonic, model UR-20 P; Tomy Seiko, Co., Ltd., Tokyo, Japan) and confirmed that DNA fragments of ∼2000-bp size were mainly found by agarose gel electrophoresis. The sonicated sample was then subjected to immunoprecipitation using anti-H3K9me3 (Millipore, CMA308), anti-H3K27ac (Millipore, CMA309) antibodies and normal mouse IgG (Millipore). Immunoprecipitated DNA was analyzed by PCR using primers F1: 5′- TAACCCTGTCAGCCGCTCAGCCTTAAATGT -3′ and R1: 5′- AGAGCACTTCACATGTGGCAGGAGTGTGGG -3′ to amplify a fragment of the MUC5AC promoter region.