For both in vivo and in vitro applications, knockdown efficiency was calculated via qPCR: RNA was extracted with the Zymo Direct-Zol RNA microprep kit (#R2062, Zymo); cDNA synthesis was performed with the SuperScript IV First Strand Synthesis System using oligo-dT priming (#18091050, Thermo); and qPCR was performed with PowerUp SYBR Green Master Mix (Thermo, #A25918) using primers listed in
Oligo dt priming
Oligo (dT) priming is a laboratory tool used for cDNA synthesis. It utilizes synthetic oligonucleotides that bind to the polyA tail of mRNA molecules, serving as primers for reverse transcriptase enzymes to initiate the conversion of mRNA into complementary DNA (cDNA).
Lab products found in correlation
13 protocols using oligo dt priming
Purification and Analysis of Cortical Projection Neurons
For both in vivo and in vitro applications, knockdown efficiency was calculated via qPCR: RNA was extracted with the Zymo Direct-Zol RNA microprep kit (#R2062, Zymo); cDNA synthesis was performed with the SuperScript IV First Strand Synthesis System using oligo-dT priming (#18091050, Thermo); and qPCR was performed with PowerUp SYBR Green Master Mix (Thermo, #A25918) using primers listed in
RNA Extraction and cDNA Synthesis
Quantifying clag3 Gene Expression
Reverse Transcription and qPCR Analysis
Chicken scFv Library Construction for Anti-PSA
Quantitative Expression Analysis of TRIM32
TRIM32, forward primer: 5’‐AGGGGATACACAAGCCCTTT‐3’,
reverse primer: 5’‐TCTCAATCCAAGATGGCACA‐3’;
GAPDH, forward primer: 5’‐GAGTCAACGGATTTGGTCGT‐3’,
reverse primer: 5’‐TTGATTTTGGAGGGATCTCG‐3’.
Generating Anti-mouse C5 Chimeric Antibody
Isolation of scFv antibodies against H3N2 influenza
First-strand cDNA was synthesized using SuperScriptTM reverse transcriptase with oligo (dT) priming (Invitrogen, Grand Island, NY, USA). Using this cDNA, a phage-display library of human single-chain variable fragments (scFv) was constructed using the pComb3XSS phagemid vector as previously described [17 ]. Four rounds of panning were performed to select scFv clones from the library [17 ]. For each round of biopanning, 1.5 μg recombinant His-tagged trimeric HA protein from the A/Brisbane/10/2007 strain (Influenza Reagent Resource, Manassas, VA, USA) was used to coat 5×106 magnetic beads (Dynabeads M-270 epoxy) (Invitrogen) used for scFv retrieval.
Quantification of Mcl-1 Expression by qRT-PCR
Mcl‐1, forward primer: 5′‐GGGCAGGATTGTGACTCTCATT‐3′,
reverse primer: 5′‐GATGCAGCTTTCTTGGTTTATGG‐3′;
GAPDH, forward primer: 5′‐GAGTCAACGGATTTGGTCGT‐3′,
reverse primer: 5′‐TTGATTTTGGAGGGATCTCG‐3′.
Quantification of DISC1 Transcripts in PC12 Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!