Scramble control sirna

Manufactured by Qiagen

Sourced in Germany

The Scramble control siRNA is a laboratory reagent designed to serve as a negative control in RNA interference (RNAi) experiments. It is a non-targeting siRNA sequence that does not have any known interaction with cellular gene expression. This control can be used to assess the specificity of the silencing effects observed with experimental siRNA targets.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) Hiperfect transfection reagent, by Qiagen (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions) Fugene hd, by Promega (1 mentions) On target smart pool sirna to msh2, by Horizon Discovery (1 mentions) Sirnas, by Qiagen (1 mentions) Bovine serum albumin (bsa), by Merck Group (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Dulbecco phosphate buffered saline (dpbs), by Thermo Fisher Scientific (1 mentions) Rpmi 1640 with l glutamine, by Thermo Fisher Scientific (1 mentions) Ficoll paque, by GE Healthcare (1 mentions) Tmb substrate, by GE Healthcare (1 mentions)

Spelling variants of this product

Control siRNA (158 citations) SiRNAs (104 citations) Scramble siRNA (13 citations) Scramble control (5 citations)

4 protocols using scramble control sirna

Zaire EBOV Infection in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Scramble control siRNA and siRNAs targeting EDC4, EDC3ti and DCP2 were purchased from Qiagen (Hilden, Germany). HeLa cells were seeded at 6000 cells per well in 96-well dishes. siRNAs were transfected at a concentrations of 5nM (EDC4 siRNA) or 10nM (EDC3 and DCP2) siRNA per 96 well using 0.3μL of Lipofectamine RNAiMax transfection reagent (Thermofisher Scientific, Waltham MA). 24 hours post transfection, cells were washed in growth media and infected with Zaire EBOV. For EDC4 expression experiments, full-length and truncated EDC4 plasmids were transfected into HeLa cells at 0.1μg per 96 well using TransIT-LT1 (MirusBioti Madison WI) according to the manufacturer’s protocol. 24 hours post transfection, cells were challenged with Zaire-EBOV.

Davey R., Donahue C., Kesari A., Thakur N., Wang L., Hulsey-Stubbs S., Williams C., Kirby C., Leung D., Aryal U., Basler C, & LaCount D. (2024). A protein-proximity screen reveals Ebola virus co-opts the mRNA decapping complex through the scaffold protein EDC4. Research Square.

+ Open protocol

+ Expand

Sprouty 2 Knockdown in hESC-Derived Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knockdown Sprouty 2 in the hESC-derived neurons, the cells were transfected in 6-well plates with 20 nM Sprouty 2 siRNA or scramble control siRNA (Qiagen) following instructions provided by the manufacturer. To eliminate any possible bias introduced by well position in each plate, the wells were assigned randomly to the various experimental groups. Briefly, a mix of opti-MEM and siRNA was prepared and 12 μL of HiPerFect Transfection Reagent (Qiagen) was added to the mixture. The mixture was incubated at room temperature for 10 minutes. Fresh culture media was added to each well and the siRNA mixture was added dropwise to the appropriate wells. The cells were then incubated at 37°C for 48 hours. These doses and times produced the largest knockdown as implicated by dose and time studies performed in these cells (data not shown). Following the transfection period, a subset of cells was used to confirm the Sprouty 2 knockdown by qRT-PCR. The remaining cells were exposed for 6 hours to 20 μg/mL propofol or DMSO. The effect of Sprouty 2 knockdown on propofol-induced toxicity was assessed by TUNEL staining.

Twaroski D.M., Yan Y., Olson J.M., Bosnjak Z.J, & Bai X. (2014). Downregulation of MicroRNA-21 is Involved in the Propofol-Induced Neurotoxicity Observed in Human Stem Cell-Derived Neurons. Anesthesiology, 121(4), 786-800.

+ Open protocol

+ Expand

Targeted Gene Silencing in HEK293T and HeLa Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

About 200,000 HEK293T cells were plated in each well of a 6-well plate. After 24 h, siRNAs (20 nM, Qiagen) were transfected into the cells using Lipofectamine RNAiMAX (Invitrogen, 13778075) according to the manufacturer’s instructions. Cells transfected with scramble-control siRNA (Qiagen, 1022076) were used as controls. Cells were harvested at 72 h after transfection for RNA and protein analysis. The sequences of the siRNA target MLH1 were GTGGCTCATGTTACTATTACA and AACCATCGTCTGGTAGAATCA. The sequences for the siRNA target MSH2 were TCCAGGCATGCTTGTGT TGAA and CCCATGGGCTATCAACTTAAT.
Hela cells were reverse transfected with 20 nM On-target Smart Pool siRNA to MSH2 (Dharmacon) using Lipofectamine RNAiMAX (Invitrogen). Plasmid DNA(pcDNA-DEST40-RGSHis-MSH2)[70 (link)] were transfected with FugeneHD (Promega) at a DNA:FugeneHD ratio of 1:3, according to the manufacturer’s instructions. For transfection in 6-well plates, 1 μg of plasmid DNA per well was used. The mix of siRNA and plasmid was then added to newly-seeded cells and medium replaced with complete DMEM after 24 hours. Experiments were performed at 72 hours after transfection.

Liu Q., Zhu X., Lindström M., Shi Y., Zheng J., Hao X., Gustafsson C.M, & Liu B. (2020). Yeast mismatch repair components are required for stable inheritance of gene silencing. PLoS Genetics, 16(5), e1008798.

+ Open protocol

+ Expand

Zinc Homeostasis Regulation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol, RPMI 1640 with L-glutamine, and DPBS were purchased from Invitrogen (Carlsbad, CA). Zinc Sulfate heptahydrate, LPS L-4516 from E.coli and BSA were purchased from Sigma-Aldrich (St. Louis, MO). Ficoll-Paque and TMB substrate were purchased from GE Healthcare (Little Chalfont, UK). Rabbit polyclonal antiserum anti-peptide to amino acid residues 225–243 of human ZIP8 (1:1000) was purchased from Covance (Princeton, NJ). Mouse anti-human monoclonal β-Actin (#69101) (1:10,000) antibody was purchased from MP Biomedicals (Santa Ana, CA). Rabbit anti-human monoclonal Lamin B1 (#377001) (1:1000) antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-human monoclonal C/EBPβ (#1479–1) (1:1000) antibody was purchased from Epitomics (Burlingame, CA). Rabbit anti-human monoclonal NF-κB1 p105/p50 (#12540) (1:2000), polyclonal ERK (#4695) (1:1000), polyclonal p-ERK (#9101) (1:1000), polyclonal p38 (#9212) (1:2000), monoclonal p-p38 (#9215) (1:2000) and polyclonal p-C/EBPβ (#3084) (1:1000) antibodies were purchased from Cell Signaling Technology (Danvers, MA). C/EBPβ TransAM ELISA kit was purchased from Active Motif (Carlsbad, CA). ZIP8 epitope specific, 21mer small interfering RNA (siRNA) (target sequence TAGGACTTAGGAAATAAATAA) and scramble control siRNA were purchased from QIAGEN (Hilden, DEU).

Pyle C.J., Akhter S., Bao S., Dodd C.E., Schlesinger L.S, & Knoell D.L. (2017). Zinc Modulates Endotoxin-Induced Human Macrophage Inflammation through ZIP8 Induction and C/EBPβ Inhibition. PLoS ONE, 12(1), e0169531.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!