Human α thrombin

Sources of the expression constructs, antibodies and siRNAs are provided in Supplemental Experimental Procedures. mRFP-(rat)CLIP-170 was generated from EGFP-CLIP-170 (Komarova et al., 2005 (link)) by substituting EGFP with monomeric RFP. For EB3-Ct-mRFP, the C-terminus (residues 200–281) of EB3 was amplified by PCR and sub-cloned into the pmRFP-N1 vector (a gift from Dr R. Tsien) at Sal1 and BamH1 sites. Expression constructs for the siRNA-insensitive form of EB3 and EGFP-IP₃R3(T804A) were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies).
DAPI (4′,6-diamidino-2-phenylindole dihydrochloride) was from Sigma. Human α-thrombin was from Fischer. The PAR-1-activating peptide (PAR1-AP, TFLLRN-NH₂, ~90% purity) was synthesized by the Research Resources Core at UIC. Sources of other materials are provided in the relevant methods sections.

The NAAO (Sigma Aldrich, Whatman), having nominal pore diameters of 20 nm and membrane thickness of 50 µm, were used for the experiments. This membrane was chosen based on earlier reports and with respect to the sizes of the biomolecules involved.^{16 –18 (link)} Thiolated thrombin-binding aptamer (TBA) was obtained from Integrated DNA Technologies (IDT) with the sequence 5’-/5ThioMC6-D/GCCTTAACTGTAGTACTGGTGAAATTGCTGCCATTGGTT GGTGTGGTTGG-3’. The bold letters denote the aptamer sequence that binds selectively to Human α-thrombin.^{19 , 20 (link)} Human α-thrombin, γ-thrombin, serum albumin (HSA), lysozyme, and 6-mercapto-1-hexanol (MCH) were procured from Thermo-Fisher Scientific. The electrolyte used for sensing experiments was 1 mM Fe(CN)₆^4-/Fe(CN)₆^3-redox couple in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO_4, 5 mM MgCl₂, pH 7.4 at room temperature). All the chemicals used for electrolyte were purchased from Sigma-Aldrich. All solutions were prepared with double distilled water (ddH₂O) produced by a Corning Mega-Pure system.