Total RNA was isolated from the kidney cortex and OM with a Nucleospin RNA II mini kit according to the manufacturer’s protocol (Macherey Nagel, Düren, Germany). RNA concentration was determined by spectrophotometry at 260 nm and the samples were then stored at −80°C. cDNA synthesis was performed using 0.5 μg of RNA with the AffinityScript QPCR cDNA synthesis kit (Life Technologies, Thermo Fisher Scientific, Cambridge, MA). For QPCR, 100 ng of cDNA served as the template for PCR amplification using the SYBR® Green QPCR Master Mix according to the manufacturer’s instructions (Life Technologies) by using an Aria Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA, United States). GAPDH was the control gene. The primer sequences were as follows: αENaC: sense 5′-TTCTGCACCAACACCACCAT-3′ and anti-sense 5′-GTTGAGGCTCACTGGGTAGC-3′; βENaC: sense 5′-CTGTGTCTTCCAGCCTGACA-3′ and anti-sense 5′-GCAGCCTCAGGGAGTCATAG-3′; γENaC: sense 5′-CTACCAGCAACACCCCAACT-3′ and anti-sense 5′-GCTACAGGATTGCTTGCACA-3′; and GAPDH: sense 5′-TAAAGGGCATCCTGGGCTACACT-3′ and anti-sense 5′-TTACTCCTTGGAGGCCATGTAGG-3′.
Nucleospin rna 2 mini kit
Manufactured by Macherey-Nagel
Sourced in Germany
The NucleoSpin RNA II mini kit is a product designed for the isolation of high-quality total RNA from various sample sources, including cells, tissues, and bacteria. The kit utilizes a silica membrane-based technology to efficiently capture and purify RNA, ensuring reliable results for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green qpcr master mix, by Thermo Fisher Scientific (6 mentions)
Aria mx3000p qpcr system, by Agilent Technologies (6 mentions)
Affinityscript qpcr cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
Brilliant sybr green qpcr master mix, by Thermo Fisher Scientific (5 mentions)
Revertaid first strand synthesis kit, by Thermo Fisher Scientific (4 mentions)
Aria mx3000p, by Agilent Technologies (2 mentions)
Affinityscrips qpcr cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr fast qpcr master mix, by Roche (1 mentions)
Primer express v3, by Thermo Fisher Scientific (1 mentions)
Qscript cdna synthesis kit, by Quantabio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr master mix, by Agilent Technologies (1 mentions)
14 protocols using nucleospin rna 2 mini kit
1
Quantitative PCR Analysis of ENaC Subunits
2
Quantitative PCR Analysis of Kidney Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from the kidney cortex with a NucleoSpin RNA II mini kit following the manufacturer's protocol (Macherey-Nagel, Düren, Germany). RNA was quantitated by spectrophotometry and stored at −80°C. cDNA was synthesized from 0.5 μg purified RNA using the AffinityScript qPCR cDNA synthesis kit (Life Technologies). For qPCR, 100 ng cDNA served as the template for PCR amplification using the SYBR® Green qPCR Master Mix according to the manufacturer's protocol (Life Technologies). mRNA levels were validated by an Aria Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA, USA) with Gapdh as a control gene. Primers used for qPCR amplification are specified in Table 1 .
3
Quantification of Inflammatory Markers in Renal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was harvested from renal tissue by Nucleospin RNA II mini kit following manufacturer's protocol (Macherey Nagel, Germany). The concentration of RNA was measured by spectrophotometry at 260 nm. Synthesis of cDNA was performed using 0.5 μg of RNA and the AffinityScript qPCR cDNA synthesis kit (Life Technologies, Thermo Fisher Scientific, USA). For qPCR reaction 100 ng of cDNA was used in combination with SYBR® Green qPCR Master Mix according to manufacturer's protocol (Life Technologies). The reaction was performed using an Aria Mx3000p (Agilent Technologies, USA). Primers used for this project were MIP‐2 forward: CTCTCAAGGGCGGTCAAAAAGTT, MIP‐2 reverse: TCAGACAGCGAGGCACATCAGGTA.
KC Forward: GCGAATTCACCATGATCCCAGCCACCCG, KC reverse: GCTCTAGATTACTTGGGGACACCTTTTAG. 18S forward: TGTGGTGTTGAGGAAAGCAG, and 18S reverse: TCCCATCCTTCACATCCTTC.
KC Forward: GCGAATTCACCATGATCCCAGCCACCCG, KC reverse: GCTCTAGATTACTTGGGGACACCTTTTAG. 18S forward: TGTGGTGTTGAGGAAAGCAG, and 18S reverse: TCCCATCCTTCACATCCTTC.
4
Mouse Cortex RNA Isolation and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse cortex with a NucleoSpin RNA II mini kit following the manufacturer’s instructions (Macherey-Nagel, Germany). Synthesis of cDNA was performed on 0.5 μg RNA using the RevertAid First Strand cDNA Synthesis KIT (Thermo Scientific, USA). For qPCR, 100 ng cDNA served as a template for PCR amplification using Brilliant SYBR Green QPCR Master Mix following the manufacturer’s instructions (Thermo Scientific).
5
Transcriptional Analysis of EP Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cortical tissue and PCKS was isolated using the NucleoSpin RNA II mini kit (Macherey Nagel, Nordrhein‐Westfalen, Germany), while TRIzol Reagent (Life Technologies, Thermo Fisher Scientific, MA, USA) was used to isolate RNA from MDCK cells and HRFs. The RNA concentration was measured with spectrophotometry and samples were stored at −80°C until use. cDNA was synthesized using the RevertAid First Strand Synthesis Kit #K1622 (Thermo Fisher Scientific, MA, USA). Brilliant SYBR Green qPCR master Mix (Thermo Fisher Scientific, MA, USA), forward and reverse primers (Table 4 ) specific to the gene of interest were added and qPCR was carried out.
To confirm the expression of the EP receptors in MDCK cells and HRFs, RT‐PCR was performed either in the presence (+) or absence (−) of reverse transcriptase. To visualize the PCR product, electrophoresis was performed using a 1% agarose gel including the Genruler DNA marker (Invitrogen, CA, USA) and images were obtained on an Azure c200 gel imaging workstation.
To confirm the expression of the EP receptors in MDCK cells and HRFs, RT‐PCR was performed either in the presence (+) or absence (−) of reverse transcriptase. To visualize the PCR product, electrophoresis was performed using a 1% agarose gel including the Genruler DNA marker (Invitrogen, CA, USA) and images were obtained on an Azure c200 gel imaging workstation.
6
Kidney Cortex RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the kidney cortex with a Nucleospin RNA II mini kit following the manufacturer’s protocol (Macherey Nagel, Düren, Germany). RNA concentration was quantified by spectrophotometry at 260 nm and then stored at −80°C. cDNA synthesis was performed on 0.5 μg of RNA with the AffinityScrips QPCR cDNA synthesis kit (Life Technologies, Thermo Fisher Scientific, Cambridge, MA). For QPCR, 100 ng of cDNA served as the template for PCR amplication using the SYBR® Green QPCR Master Mix according to the manufacturer’s instructions (Life Technologies) running on an Aria Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA). GAPDH was used as control gene. The sequences of the primers used are shown in Table 1 .
7
Quantification of AQP3 mRNA in Cortical Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from human cortical tissue using a Nucleospin RNA II mini kit following the manufacturer’s protocol (Macherey Nagel, Düren, Germany). The concentration of RNA was quantified by spectrophotometry at 260 nm. cDNA synthesis was performed using 0.5 µg RNA with the AffinityScrips qPCR cDNA synthesis kit (Life Technologies, Thermo Fisher Scientific, Cambridge, MA, USA). For the qPCR reaction, 100 ng cDNA was used in combination with SYBR Green qPCR Master Mix according to the manufacturer’s instructions (Life Technologies). The reaction was run on an Aria Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA, USA). AQP3 mRNA expression was calculated relative to RPL22, which was used as reference gene. The primer sequences used were: AQP3, for-5′ ACTCCAGTGTGGAGGTGGAC and rev-5′ AGTGACAG-CAAAGCCAAAGG; RPL22, for-5′ GGAGCAAGAGCAAGATCACC and rev-5′ TGTTAG-CAACTACGCGCAAC.
8
Quantitative RT-PCR Analysis of Osteoclast Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from spleen-derived OCLs using a NucleoSpin RNA II mini kit (Macherey-Nagel, Düren, Germany). DNase-treated RNA (1 μg) was reverse transcribed using a qScript cDNA synthesis kit (QuantaBio, Beverly, MA, USA). cDNA was subjected to qRT-PCR using SYBR FAST qPCR master mix (KAPA Biosystems, Wilmington, MA, USA) on a Step One Plus real-time PCR system (Applied Biosystems, Foster City, CA, USA). Readings were normalized to mouse actin. Primers (Table S1 ) were designed using Primer Express v.3 (Applied Biosystems) and validated by a standard curve and dissociation curve of the products. The fold change in target gene expression was calculated by the 2−ΔΔCt relative quantification method (Applied Biosystems).
9
RT-PCR Analysis of EP2 Receptor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using either TRIzol Reagent (cells) or a NucleoSpin RNA II mini kit (kidney tissue; Macherey Nagel), following the manufacturer's instructions. RNA was quantitated by spectrophotometry and stored at −80°C. cDNA was synthesized from 0.5 μg RNA with the RevertAid First Strand synthesis kit (Thermo Scientific). To confirm expression of the EP2 receptor in MDCK cells, RT‐PCR was performed with (+) or without (−) reverse transcriptase (RT) enzyme. Afterwards, the PCR product was analysed by electrophoresis using a 1% agarose gel run at 70 V for 45 min, including a marker (Generuler DNA marker, Invitrogen). Images of the gel were obtained with an Azure c200 gel imaging workstation. To study the expression level of the other genes of interest, qPCR was performed using 100 ng cDNA, which served as the template for PCR amplification using the Brilliant SYBR Green qPCR Master Mix (Thermo Scientific), according to the manufacturer's instructions. Used primers are listed in Table 4 .
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the other half of the bladder were isolated using a Nucleospin RNA II mini kit, as stated in the manufacturer’s manual (Macherey Nagel, Düren, Germany). The RNA concentration was measured spectrophotometrically at 260 nm, and samples were then stored at -80°C. The AffinityScript qPCR cDNA synthesis kit (Life Technologies, Thermo Fisher Scientific, Cambridge, MA) was used to synthesize cDNA. For qPCR analysis, 100 ng of cDNA served as the template for PCR amplification using SYBR® Green qPCR Master Mix according to the manufacturer’s instructions (Life Technologies) on an Aria Mx3000P qPCR System (Agilent Technologies, Santa Clara, CA, United States) with β-actin as the control gene. The primer sequences for gene of interest are shown in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!