Total RNA was isolated from paraffin-embedded tissues and NPC cells using RecoverAll™ Total Nucleic Acid Isolation Kit (Thermo Fisher, CA, USA) and TrizolTM reagent (Thermo Fisher, CA, USA), respectively, according to the instructions. Then, miDETECT A Track miRNA qPCR Kit (RiBoBio, Guangzhou, China) was applied to reversely transcribe mRNAs into cDNA and detect the relative expression of miR-181a using specific primers. The level of snRNA U6 was simultaneously detected for normalization of miR-181a expression employing the comparative Ct method. The primers for miR-181a (catalog number, MQPS0000317-1) and U6 (catalog number, miRA0000256-1) were purchased from RiBoBio Inc (Guangzhou, China) and the sequence information was not offered for commercial confidentiality.
Midetect a track mirna qpcr kit
Manufactured by RiboBio
Sourced in China
The MiDETECT A Track™ miRNA qPCR kit is a laboratory equipment product designed for the quantitative detection of microRNA (miRNA) expression levels. The kit utilizes real-time quantitative PCR technology to accurately measure the abundance of specific miRNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Midetect a track mirna qrt pcr starter kit, by RiboBio (2 mentions)
Recoverall total nucleic acid isolation kit, by Thermo Fisher Scientific (1 mentions)
Uni reverse primer, by RiboBio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Abi 7500 pcr system, by Thermo Fisher Scientific (1 mentions)
Rnaiso, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Superscript first strand synthesis system, by Promega (1 mentions)
Tb green premix ex taq tli rnaseh plus, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser perfect real time kit, by Takara Bio (1 mentions)
Rnase r, by RiboBio (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Rna extraction kit, by Thermo Fisher Scientific (1 mentions)
Rnase r, by Geneseed (1 mentions)
Aceq universal sybr qpcr master mix, by Vazyme (1 mentions)
Icycler system, by Bio-Rad (1 mentions)
Hiscript 2 q rt supermix for qpcr, by Vazyme (1 mentions)
7 protocols using midetect a track mirna qpcr kit
1
Quantifying miR-181a Expression in Tissues
2
Comprehensive RNA Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and tissues with TRIzol® reagent (cat. no. 15596026; Invitrogen; Thermo Fisher Scientific, Inc.). For RT, Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (cat. no. 11123ES60; Shanghai Yeasen Biotechnology Co., Ltd.) was used following the manufacturer's instructions. qPCR for these genes was performed using Hieff® qPCR SYBRGreen Master Mix (cat. no. 11201ES08; Shanghai Yeasen Biotechnology Co., Ltd.) with ACTB serving as an internal control under the following parameters: 95°C for 5 min; followed by 40 cycles at 95°C for 5 min and 60°C for 30 sec. Primers for HIF1α, integrin subunit αV (ITGAV), integrin subunit β (ITGB)3, ITGB5, E-cadherin, heparin-binding EGF-like growth factor (HBEGF), FUT4, FUT7, ST3Gal3 and ACTB were obtained from Generay Biotech (Shanghai) Co., Ltd. and are listed in Table SII . The detection of miRNA in cells and tissues was the same as that in SCM, using U6 as an internal reference. miDETECT A Track U6 forward primer (cat. no. miRAN0002) and Uni-Reverse Primer (included in miDETECT A Track™ miRNA qPCR kit) were provided by Guangzhou RiboBio Co., Ltd. The relative mRNA levels were determined using the 2−ΔΔCq method.
3
Quantifying mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mRNA quantification, total RNAs were isolated using RNAiso(Takara, Shiga, Japan) Plus. And 1 µg of total RNA was used for cDNA synthesis using Prime Script RT Master Mix according to the instructions (Takara). Real-time PCR reactions were run on ABI 7500 PCR system (Applied Biosystems, Carlsbad, CA, USA) using SYBR Premix Ex Taq (Takara). The PCR program consisted of 40 cycles at 95°C for 15 s and 60°C for 34 s. Gene expression was determined relative to β-actin (for mRNA) or U6 (for miRNA) and calculated using the 2−ΔΔCT method. The miDETECT A Track™ miRNA qPCR Kit (RIBOBIO, Guangzhou, China) was used to examine the levels of mature miR-223. The gene-specific primers are listed in Supplementary Table S2
4
Quantification of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used TRIzol® reagent (Invitrogen Life Technologies, Grand Island, NY, USA) to isolate total RNA. RNA (2.5 µg) was reverse-transcribed into cDNA using the Superscript first-strand synthesis system (Promega, Madison, WI, USA), and 1 µg RNA was reverse-transcribed using the miDETECT A Track™ miRNA qPCR kit (RiboBio, Guangzhou, China) following the manufacturers’ instructions. qPCR was carried out as previously described (Han et al., 2019 (link)). U6 and RPS18 served as miRNA and mRNA endogenous controls, respectively. The data were analyzed by the 2−ΔΔCt method. Primers were designed as shown in Table 1 .
5
Verification of ceRNA Network Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA expressions involved in the ceRNA network in each group were verified by qRT-PCR. For mRNA and lncRNA verifications, PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (TaKaRa, RR047A, Japan) was deployed in reverse transcription procedure. Subsequently, qPCR was conducted, and TB Green® Premix Ex Taq ™ (Tli RNaseH Plus) (TaKaRa, RR420A, Japan) was deployed. The miRNA verification process involved the utilization of the miDETECT A TrackTM miRNA qRT-PCR Starter Kit (C10712, RIBOBIO, China) and the miDETECT A TrackTM miRNA qPCR Kit (C10711, RIBOBIO, China). The quantification of mRNA, lncRNA, and miRNA expression levels was conducted utilizing the 2- ΔΔCT approach. ACTB and GAPDH were used as reference genes for mRNA and lncRNA, U6 and 5S were used as reference genes for miRNA.
6
Comprehensive RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNA extraction kit (Invitrogen, CA, USA) was used to extract total RNA from tissues, exosomes, and cell lines. The quality and concentration of RNA were tested using NanoDrop 2000 (Thermo, Shanghai, China). Before reverse transcription of circRAPGEFF5, RNA samples were divided into two uniform parts: one part was treated with RNase R (Geneseed Biotech, Guangzhou, China) at 37 °C for 10 min, and the other part was treated with an equal amount of RNase-free ddH2O without RNase R. miDETECT A TrackTM miRNA qPCR Kit (RiboBio) was used to reverse transcribe the miRNAs. Finally, RT-qPCR was performed using an ABI Q5 PCR instrument (Applied Biosystems, CA, USA). β-actin and U6 were used as internal references. Serum exosomal circRAPGEF5 expression analysis by the 2-ΔCt method, the -ΔCt method was used for tissue samples, and other results were analyzed by the 2-ΔΔCt method. The primer sequences used are listed in Supplementary Table S1 .
7
RNA Extraction, cDNA Synthesis, and qRT-PCR for HaCaT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction from HaCaT cells was performed with Trizol™ Reagent (Invitrogen), according to the manufacturer's instructions. cDNA was synthesized from 1 μg RNA using a HiScript II Q RT SuperMix for qPCR (Vazyme, China). Then, the qRT-PCR analysis was performed with AceQ Universal SYBR qPCR Master Mix (Vazyme, China) on an iCycler System (Bio-Rad, USA). The Ct values were normalized for the housekeeping gene GAPDH. The sequences of the primers were as follows: Dsg3 upstream, 5'- CACCTACCGAATCTCTGGAGT -3', and downstream, 5'-GGGCATTTAGAGCCCGACA-3'; GAPDH upstream, 5'-CTGGGCTACACTGA-GCACC-3', and downstream, 5'- AAGTGGTCGTTGAGGGCAATG -3'. For miRNA analysis, cDNA for miRNA was synthesized using the miDETECT A TrackTM miRNA qRT-PCR Starter Kit (Ribobio, China) as described by the manufacture's protocol. The U6 RNA level was used as an internal control for data normalization. The qRT-PCR reaction was performed using miDETECT A TrackTM miRNA qPCR Kit (Ribobio, China) with the miDETECT A TrackTM miR-16-5p Forward Primer and miDETECT A TrackTM Uni-Reverse Primer (Ribobio, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!