Analytical grade reagents of DPPH (2,2-diphenyl-1-picrylhydrazyl), ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid], chloroauric acid [HAuCl4·3H2O; also known as gold(III) chloride], MTT, LPS from Salmonella enterica, X-tremeGENE siRNA, FuGENE HD transfection reagents, and other reagents were supplied by Sigma-Aldrich (St. Louis, MO, USA) and used as received. A Cytotoxicity Detection kit for determining lactate dehydrogenase content (LDH) was procured from Roche Applied Science (Rotkreuz, Switzerland). The chloromethyl derivative of H2DCFDA (CM-H2DCFDA) was supplied by Thermo Fisher Scientific Inc. (Waltham, MA, USA). Mouse TNF-α, IL-1β, and IL-6 Quantikine ELISA kits were obtained from R&D Systems Inc. (Minneapolis, MN, USA). Primary antibodies against TBP, α-tubulin, iNOS, extracellular signal-regulated kinases (ERK), c-Jun N-terminal kinase (JNK), p38, HO-1, COX-2, Nrf2, IκBα, NF-κBp65, and NQO1 were sourced from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against p-glycogen synthase kinase 3 beta (GSK-3β), GSK-3β, p-p65, p-IκBα/β), IκBα/β), p-IκBα, IκBα, STAT-1, p-STAT-1, p-ERK, p-38, p-JNK, JAK, p-JAK1, p-AMPK, and AMPK were obtained from Cell Signaling Technology (Beverly, MA, USA). siRNAs specific for mouse AMPK, HO-1, Nrf2, and NQO-1 were sourced from Santa Cruz Biotechnology.
Xtremegene sirna
Manufactured by Merck Group
Sourced in United States
Xtremegene siRNA is a lab equipment product developed by Merck Group. It is designed for the delivery of small interfering RNA (siRNA) into cells for the purpose of gene silencing. The core function of Xtremegene siRNA is to facilitate the introduction of siRNA molecules into target cells, enabling researchers to study the effects of gene knockdown.
Automatically generated - may contain errors
Lab products found in correlation
Psi check2 luciferase reporter, by Promega (2 mentions)
Quickchange lightning kit, by Agilent Technologies (2 mentions)
Dual luciferase assay kit, by Promega (2 mentions)
Chloroauric acid, by Merck Group (1 mentions)
P stat1, by Cell Signaling Technology (1 mentions)
Lps from salmonella enterica, by Merck Group (1 mentions)
P ampk, by Cell Signaling Technology (1 mentions)
P iκbα, by Cell Signaling Technology (1 mentions)
P jak1, by Cell Signaling Technology (1 mentions)
Nf κb p65, by Santa Cruz Biotechnology (1 mentions)
C jun n terminal kinase jnk, by Santa Cruz Biotechnology (1 mentions)
Il 6 quantikine elisa kit, by R&D Systems (1 mentions)
Cox 2, by Santa Cruz Biotechnology (1 mentions)
α tubulin, by Santa Cruz Biotechnology (1 mentions)
Stat1, by Cell Signaling Technology (1 mentions)
Gsk3β, by Cell Signaling Technology (1 mentions)
P jnk, by Cell Signaling Technology (1 mentions)
P erk, by Cell Signaling Technology (1 mentions)
Methyl thiazolyl tetrazolium (mtt), by Merck Group (1 mentions)
2 2 azinobis 3 ethylbenzothiazoline 6 sulfonic acid (abts), by Merck Group (1 mentions)
3 protocols using xtremegene sirna
1
DPPH and ABTS Antioxidant Assays for Cytotoxicity and Immune Modulation
2
NEDD4L 3'UTR Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RBP-Jk reporter plasmid was acquired from SABiosciences (a Qiagen company). The reporter was transfected with Xtremegene siRNA (Sigma Aldrich), and 48hr lysates were analyzed using the dual luciferase assay kit (Promega, Madison, WI, USA). RBP-jK luciferase are representative experiments from two reproducible experiements for each cell lines, and show technical replicates of 3. For 3′UTR experiments, the 3′UTR of NEDD4L was cloned into the psi-Check2 luciferase reporter (Promega), and transfection and analysis was performed as above. The miR mimics with UTR experiment was reproduced twice, with representative experiment shown in Figure 4D . Figure 4E was reproduced three times, with representative experient shown. To mutate the three microRNA binding sites in the NEDD4L 3′UTR we performed site directed mutagenesis using the QuickChange Lightning kit (Agilent Technologies, Santa Clara, CA, USA) and the following oligonucleotide sequences: gcaaaagtctgttaggcaaatgcaatatttcaagcagaacttgcttgaagaacaa, tgttgtaaatgcaccaattctgaaggaaatatatgtactacatggaggtcatatctg, ccagattcacaattgatagatacttctccggaaagatgtgtgcagggaa.
3
NEDD4L 3'UTR Reporter Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!