RNA was extracted using Tri-reagent (Sigma) according to the manufacturer’s instructions. RNA (1 μg) was used for cDNA synthesis using random primers and a cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative PCR (qPCR) analysis was carried out on a ABI7900HT fast system (Applied Biosystems) using Taqman Universal PCR Master Mix (Applied Biosystems), according to manufacturer’s instructions for p15 (HS00793225_m1), p16 (HS04189686_m1), p21 (HS00355782_m1) and p27 (HS00153277_m1), with GADPH (HS02758991_g1) as an endogenous control (Applied Biosystems).
Abi 7900ht fast system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7900HT Fast System is a real-time PCR instrument designed for high-throughput gene expression analysis. It features a 384-well block format and supports fast cycling protocols to enable rapid sample processing. The system is capable of performing real-time PCR experiments with a variety of fluorescent chemistries and can detect up to four different targets simultaneously.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Allprep dna rna mirna universal kit, by Qiagen (2 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Quantinova sybr green pcr kit, by Qiagen (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Taqman genotyping master mix, by Thermo Fisher Scientific (1 mentions)
A260 a280 absorbance ratios, by Thermo Fisher Scientific (1 mentions)
Fast sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
6 protocols using abi 7900ht fast system
1
Quantitative Analysis of Cell Cycle Regulators
2
Circular RNA and miRNA Expression in Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from osteosarcoma tissues and cells using TRIzol Reagent (Invitrogen, USA). First strand cDNA was synthesized from RNA using a First-strand cDNA Synthesis Kit (Merck, USA) and HyperScript III miRNA 1st Strand cDNA Synthesis Kit (Novabio, China). Quantitative PCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, USA), running on an ABI 7900HT Fast System (Applied Biosystems). Target gene expression was analyzed using the 2-ΔΔCt method, normalized to GAPDH or U6. The primers used in this study are listed in Table 1 .Table 1
PCR primers used in this study.
| Targets | Primers | Sequences (5′ to 3′) |
|---|---|---|
| circ_0088212 | Forward | CAGAAATATTTTGCCACTGTTGA |
| Reverse | AGCGTGGGTCTTTGTTGTCT | |
| miR-520h | Forward | TCGCGACAAAGTGCTTCCCT |
| Reverse | GTGCAGGGTCCGAGGT | |
| APOA1 | Forward | CCCAGTTGTCAAGGAGCTTT |
| Reverse | TGGATGTGCTCAAAGACAGC | |
| GAPDH | Forward | CCACCCATGGCAAATTCCATGGGA |
| Reverse | TCTAGACGGCAGGTCAGGTCCACC | |
| U6 | Forward | AAAGCAAATCATCGGACGACC |
| Reverse | GTACAACACATTGTTTCCTCGGA |
3
Quantification of miR-543 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell lines and frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using an miRNA reverse transcription kit (Shanghai GenePharma Co., Ltd., Shanghai, China) according to the manufacturers instructions. Then, the expression levels of miR-543 were quantified using a QuantiNova SYBR-Green PCR kit (Qiagen, Hilden, Germany) with the ABI 7900HT Fast system (Applied Biosystems, Foster City, CA, USA). Primer sequences of miR-543 were CAGTGCTAAAACATTCGCGG (forward) and TATGGTTGTTCACGACTCCTTCAC (reverse). The U6 gene was used as an internal reference. The primer sequences were synthesized by Shanghai GenePharma. The reaction was performed for 40 cycles under following conditions: denaturation at 95°C for 3 min, 95°C for 10 sec and 55°C for 30 sec. The relative expression ratio of miR-543 was calculated using the 2−ΔΔCT method.
4
Quantifying FGFR1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue specimens using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN). Total RNA (0.5 μg) was reverse transcribed to complementary DNA (cDNA) using the PrimeScript RT Master Mix (TaKaRa Bio, Otsu, Japan), according to the manufacturer's protocol. Real‐time quantitative reverse transcription PCR (RT‐qPCR) was used to assess FGFR1 mRNA expression. Real‐time RT‐qPCR was carried out in a solution containing 5.0 μL of 2 × TaqMan Fast Advanced Master Mix (Applied Biosystems), 0.5 μL of TaqMan Gene Expression Assay (FGFR1: Hs00915142_m1, β‐Actin: Hs01060665_g1, PUM1: Hs_00982775_m1, TAF‐10: Hs00359540_g1, Applied Biosystems), 3.5 μL of nuclease‐free water and 1.0 μL of cDNA sample (10 ng/μL) in a final volume of 10 μL. Thermal cycling was performed in an ABI 7900HT Fast System (Applied Biosystems). Negative controls were included in each run. Relative mRNA levels were determined from the threshold cycle for amplification using the ΔΔCt method. Determination of Ct values was performed in duplicate and normalized to the Ct values of simultaneous duplicate measurements of the expression of three housekeeping genes, β‐Actin, PUM1 and TAF‐10, from the same samples. These housekeeping genes were selected based on our previous study.19
5
Quantifying FGFR1 Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each patient's gDNA was extracted by using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN, Venlo, the Netherlands) following the manufacturer's protocol. The concentration and purity of the prepared gDNA were measured by the A260/A280 absorbance ratios (Nano‐Drop Technologies, Wilmington, DE, USA). FGFR1 gene amplification was analyzed with copy number assay by real‐time quantitative PCR (qPCR) on an ABI 7900HT Fast System (Applied Biosystems, Foster City, USA). RNase P was chosen as a reference for gene dosage because of its single copy number. Each reaction was performed in a reaction mixture containing 5.0 μL of 2 × TaqMan Genotyping Master Mix (Applied Biosystems), 0.5 μL of TaqMan Copy Number Assay (FGFR1: Hs02882334_cn; Applied Biosystems), 0.5 μL of TaqMan Copy Number Reference Assay (RNase P 20X Primer‐Probe VIC; Applied Biosystems), 2.0 μL of nuclease‐free water and 2.0 μL (10 ng) of gDNA sample in a final volume of 10 μL. Thermal cycling conditions included an initialization step at 95°C and 60 s at 60°C. Calculation of the gene copy number was carried out using the absolute quantification method. FGFR1 gene status was defined by the ratio of FGFR1 versus RNase P gene. In total, a ratio from 1.5 to <2.0 was defined as a gain, a ratio larger than or equal to 2.0 as an amplification, and a ratio less than 1.5 as normal range.
6
Quantitative PCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SYBR Green reactions were performed using the ABI 7900 HT Fast System (Applied Biosystems, Foster City, CA) in 384 well optical reaction plates. Quantitative PCR (qPCR) assays were performed to measure the expression levels of the target genes as previously described [45 ]. Briefly, aliquots (1 μl) of cDNA (2 ng/reaction) or negative controls were used as template for qPCR reactions with Fast SYBR Green PCR Master Mix (Applied Biosystems) and primers (500 nM final concentration). qPCR amplifications were carried out at 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min, and a final dissociation curve analysis step from 65°C to 95°C. Technical replicate experiments were performed for each of the biological samples, in triplicate. Amplification specificity for each reaction was confirmed by the dissociation curve analysis. The Ct values were used for further ΔΔCt analysis. The 16S rDNA was used as a reference gene to normalize samples. A relative quantification value was calculated for each gene with the control group as a reference [27 (link), 40 , 45 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!