Cd40l

Manufactured by Cell Signaling Technology

Sourced in United States

CD40L is a member of the tumor necrosis factor (TNF) superfamily. It functions as a ligand for the CD40 receptor, which is expressed on the surface of B cells, dendritic cells, and other antigen-presenting cells. CD40L plays a critical role in the activation and differentiation of B cells, as well as in the regulation of immune responses.

Automatically generated - may contain errors

Lab products found in correlation

Anti cd40, by R&D Systems (1 mentions) Nifuroxazide, by Selleck Chemicals (1 mentions) Interleukin 2 (il 2), by Thermo Fisher Scientific (1 mentions) Il 15, by Thermo Fisher Scientific (1 mentions) Ficoll paque plus, by GE Healthcare (1 mentions) Interleukin 4 (il 4), by R&D Systems (1 mentions) Cd3 cd28 t cell activator, by STEMCELL (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Lps from escherichia coli o111 b4, by Merck Group (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Gentamicin, by Thermo Fisher Scientific (1 mentions) F4 80, by BD (1 mentions) Ev depleted fbs, by System Biosciences (1 mentions) E cadherin, by Cell Signaling Technology (1 mentions) β actin, by Cell Signaling Technology (1 mentions) Protease inhibitor cocktail, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Ly 6g ly 6c, by BD (1 mentions)

Spelling variants of this product

Anti-CD40L (2 citations)

3 protocols using cd40l

CD40/CD40L Signaling Modulation in Hepatoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

HepG2.2.15 or HepAD38 cells transfected with CD40 siRNA/siCtrl were stimulated with CD40 ligand (CD40L;1 μg/ml; Cell Signaling Technology, Danvers, MA, USA), neutralizing by preincubation with monoclonal antagonistic antibody against CD40 (anti-CD40; 5 μg/ml; R&D Systems, Minneapolis, MN, USA) or antagonistic antibody against CD40L (anti-CD40L; 0.1 μg/ml; Ancell, Bayport, MN, USA) for 1 h. HepG2.2.15 or HepAD38 cells were seeded in a 6-well plate (5 x 10⁵ cells/well) overnight and then transfected with CD40 plasmid/vector. The inhibitor nifuroxazide (Selleck Chemicals, Houston, TX, USA) at a final concentration of 20 μM was added to the medium for 24 h.

Chen J., Chen H., Mai H., Lou S., Luo M., Xie H., Zhou B., Hou J, & Jiang D.K. (2022). A functional variant of CD40 modulates clearance of hepatitis B virus in hepatocytes via regulation of the ANXA2/CD40/BST2 axis. Human Molecular Genetics, 32(8), 1334-1347.

+ Open protocol

+ Expand

Isolation and Activation of Immune Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood of HDs by centrifugation on Ficoll-Paque Plus (GE Healthcare Lifesciences) gradients^{38 (link)}. CD4⁺ T, CD8⁺ T, NK and B cells were isolated from PBMCs using negative selection-based cell isolation kits from Miltenyi, #130-096-495, #136-096-533, Stem Cell Technologies, #19055, and Biolegend #480061, respectively, following manufacturers’ protocol. Isolated cells were cultured in RPMI medium supplemented with 10% (v/v) exosome-depleted and heat-inactivated FBS at 37 °C in the atmosphere of 5% CO₂ in air^{16 (link)}. T cells were activated with CD3/CD28 T cell activator (25 µl/mL, Stem Cell) and IL-2 (150 IU/mL, Peprotech) at 1 × 10⁶ cells/mL in RPMI medium for 12 h. NK cells were activated by 48 h incubation with IL-2 (100 IU/mL, Peprotech) and IL-15 (150 IU/mL, Peprotech) at 1 × 10⁶ cells/mL. B cells were activated by 12 h incubation with IL-4 (100 IU/mL, R & D System) and CD40L (0.5 ug/mL, Cell Signaling Technology, #3583 S) at 1 × 10⁶ cells/mL.

Mondal S.K., Haas D., Han J, & Whiteside T.L. (2023). Small EV in plasma of triple negative breast cancer patients induce intrinsic apoptosis in activated T cells. Communications Biology, 6, 815.

+ Open protocol

+ Expand

LPS-Induced Inflammation Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

LPS from Escherichia coli O111:B4, miR-223–3p/miR-142–3p mimics, inhibitors, and respective controls were purchased from Sigma-Aldrich. Phosphate-buffered saline (PBS), fetal bovine serum (FBS), RPMI-1640 and DMEM were purchased from Gibco. EV-depleted FBS (System Biosciences). The canonical 3’ end adenylated hsa-miR-223–3p (5’ UGUCAGUUUGUCAAAUACCCCAAAA 3’) and 3’ end uridylated miR-223 (5’ UGUCAGUUUGUCAAAUACCCCAUUU 3’) were synthesized by Integrated DNA Technologies (IDT). IDT also synthesized all the adapters and primers used in this study, as described below. Lipofectamine® 3000 reagent, gentamicin, and protease inhibitor cocktail were purchased from Thermo Fisher Scientific. NLRP3 and CD68 antibodies were purchased from Abcam. CD11c, F4/80, Ly-6G/Ly-6C, and CD45 antibodies were ordered from BD Biosciences. E-cadherin, ASC, β-actin and CD40L antibodies were ordered from Cell Signaling Technology. K. pneu (strain from ATCC#43186) was provided by Dr. Dela Cruz at Yale University School of Medicine.

Zhang D., Lee H., Wang X., Groot M., Sharma L., Dela Cruz C.S, & Jin Y. (2019). A potential role of microvesicle-containing miR-223/142 in lung inflammation. Thorax, 74(9), 865-874.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!