Nanodrop 2000

Manufactured by Promega

Sourced in United States

The NanoDrop 2000 is a spectrophotometer used to measure the concentration and purity of nucleic acid and protein samples. It utilizes a patented sample retention system that only requires 1-2 microliters of sample to perform the measurement.

Automatically generated - may contain errors

Lab products found in correlation

Rnalater buffer, by Qiagen (1 mentions) Sv total rna isolation, by Promega (1 mentions) Quantus fluorometer, by Promega (1 mentions) Quantifluor dsdna system, by Promega (1 mentions) Dneasy plant mini kit, by Qiagen (1 mentions) Genomic dna clean concentrator 10 kit, by Zymo Research (1 mentions) Rnaiso plus, by Takara Bio (1 mentions) Dnase 1, by Promega (1 mentions) M6a rna methylation assay kit, by Abcam (1 mentions) M mlv reverse transcriptase, by Promega (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Sybr primescript mirna rt pcr kit, by Takara Bio (1 mentions) Abi 7500 system, by Thermo Fisher Scientific (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Collagenase type 2, by Merck Group (1 mentions)

Spelling variants of this product

Nanodrop (14 citations) NanoDrop 2000 spectrophotometer (5 citations) NanoDrop™ 2000/2000c Spectrophotometers (3 citations)

5 protocols using nanodrop 2000

Spinal Cord Injury RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cord fragments around the injury were cut out from the vertebra after the rats were sacrificed. Then, the fragments were maintained in RNAlater buffer (Qiagen) until total RNA extraction. Another group of animals treated in parallel was used for histopathology.
Total RNA was extracted by SV Total RNA Isolation (Promega USA), and the concentration and purity were determined using a Nanodrop2000 spectrophotometer. RNA integrity was determined using agarose gel electrophoresis.

Wei J., Wang J., Zhou Y., Yan S., Li K, & Lin H. (2016). MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression. BioMed Research International, 2016, 4013487.

+ Open protocol

+ Expand

Endosperm gDNA Isolation and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA (gDNA) was isolated from the endosperms of developing grains at the 21 DAA timepoint. The lemma and palea were first removed followed by removal of the embryo. Each grain was inspected under a magnifying work light to confirm removal of the embryo. Three biological replicates were used per line. Isolated endosperm tissue was ground with a mortar and pestle before extraction. gDNA was extracted using the Qiagen DNeasy Plant Mini Kit. Extracted gDNA was further purified using the Zymo Genomic DNA Clean & Concentrator-10 Kit. Purified gDNA was quantified by spectrophotometer (Thermo Scientific NanoDrop 2000) and fluorometer (Promega Quantus Fluorometer and QuantiFluor dsDNA System). Spectrophotometer measurements were used to determine gDNA purity. Fluorometer measurements were used to quantify doublestranded DNA (dsDNA) for library kit input. After initial quantification, samples were diluted to more practical working concentrations as needed. Diluted samples were re-quantified on the fluorometer before proceeding.

Vinje M.A, & Simmons C.H. (2024). Characterization of barley (Horduem vulgare) lys3 mutants identifies genes under the regulation of the prolamin-box binding transcription factor and elucidates its role in endosperm promoter methylation during grain development. Molecular genetics and genomics : MGG, 299(1).

+ Open protocol

+ Expand

m6A RNA Methylation Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

This experiment was carried out with the m6A RNA Methylation Assay Kit (Colorimetric; Abcam, Cambridge, USA). Total RNA extracted with RNAiso Plus (TAKARA, Beijing, China) was treated with DNase I (Promega) and then detected with a NanoDrop 2000 spectrophotometer. The samples were diluted to the required concentration with RNase-free water. All other steps were performed according to the instructions of the kit, and the m6A was quantified by reading the absorbance at a wavelength of 450 nm for each well with a multifunctional microplate reader and was calculated based on the standard curve.

Jiang Z.X., Wang Y.N., Li Z.Y., Dai Z.H., He Y., Chu K., Gu J.Y., Ji Y.X., Sun N.X., Yang F, & Li W. (2021). The m6A mRNA demethylase FTO in granulosa cells retards FOS-dependent ovarian aging. Cell Death & Disease, 12(8), 744.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TRIzol Reagent (Invitrogen, Carlsbad, USA) was used for extracting total RNA according to the manufacturer's protocol. The RNA sample was quantified by NanoDrop 2000, and reverse transcribed into complementary DNA (cDNA) using M‐MLV Reverse Transcriptase (Promega, Madison, WI, USA). Followed, the SYBR‐Green Reagent kit (Qiagen, Hilden, Germany) and the SYBR PrimeScript miRNA RT PCR kit (Takara, Dalian, China) was used to detect the mRNA level of SNHG20, DDX49 and miR‐342 on ABI 7500 system (Applied Biosystems, Foster City, CA, USA). The glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) or small nuclear RNA U6 (U6) were used as endogenous control. The primers were listed as follows: SNHG20 F‐5′‐ATGGCTATAAATAGATACACG‐3′, R‐5′‐GGTACAAACAGGGAGGGA‐3′; DDX49 F‐5′‐CCTACCAGATCGCAGAGCAG‐3′, R‐5′‐ CACGTGTGGTTTCCGAGAGA‐3′; GAPDH F‐5′‐TCCCATCACCATCTTCCAGG‐3′, R‐5′‐GATGACCCTTTTGGCTCCC‐3′; miR‐342 F‐5′‐TCCTCGCTCTCACACAGAAATC‐3′, R‐5′‐TATGGTTGTTCACGACTCCTTCAC‐3′; U6 F‐5′‐AACGAGACGACGACAGAC‐3′, R‐5′‐GCAAATTCGTGAAGCGTTCCATA‐3′.

Wang X., Gu G., Zhu H., Lu S., Abuduwaili K, & Liu C. (2020). LncRNA SNHG20 promoted proliferation, invasion and inhibited cell apoptosis of lung adenocarcinoma via sponging miR‐342 and upregulating DDX49. Thoracic Cancer, 11(12), 3510-3520.

+ Open protocol

+ Expand

Adipocyte DNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated from VWAT using automated tissue DNA extraction kits (Promega) and quantified on a Nanodrop 2000. DNA was isolated from adipocytes by collagenase digestion and flotation centrifugation. Briefly, fat pads were digested in Krebs-Ringer buffer containing 1 mg/mL type II collagenase (Sigma-Aldrich, St. Louis, MO) and incubated in a shaking water bath at 37°C for 30 min. Adipocytes were isolated from stromal elements by gentle centrifugation at ∼150 rpm for 1 min. DNA was isolated by using a DNeasy Blood and Tissue kit (Qiagen).

Khalyfa A., Mutskov V., Carreras A., Khalyfa A.A., Hakim F, & Gozal D. (2014). Sleep Fragmentation During Late Gestation Induces Metabolic Perturbations and Epigenetic Changes in Adiponectin Gene Expression in Male Adult Offspring Mice. Diabetes, 63(10), 3230-3241.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!