Mmp 3 elisa kit

Manufactured by R&D Systems

Sourced in China

The MMP-3 ELISA kits from R&D Systems are quantitative sandwich enzyme-linked immunosorbent assay (ELISA) designed for the measurement of human matrix metalloproteinase-3 (MMP-3) levels in cell culture supernates, serum, and plasma. The assay employs an antibody specific for MMP-3 coated on a microplate. Standards and samples are pipetted into the wells, and any MMP-3 present is bound by the immobilized antibody. After washing away any unbound substances, an enzyme-linked polyclonal antibody specific for MMP-3 is added to the wells. Following a wash to remove any unbound antibody-enzyme reagent, a substrate solution is added to the wells, and color develops in proportion to the amount of MMP-3 bound. The color development is then stopped, and the intensity of the color is measured.

Automatically generated - may contain errors

Lab products found in correlation

Mmp 1, by R&D Systems (1 mentions) Tnf α elisa kit, by Thermo Fisher Scientific (1 mentions) Interleukin 6 (il 6), by Neobioscience (1 mentions) Ifn γ elisa kits, by Neobioscience (1 mentions) Fast start sybr green 1 kit, by Roche (1 mentions) Lightcycler, by Roche (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Omniscript rt kit, by Qiagen (1 mentions)

Close spelling variants of this product

Human Total MMP-3 ELISA kits MMP-3 ELISAs

4 protocols using mmp 3 elisa kit

Quantifying MMP-1 and MMP-3 Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Supernatants were collected at 72 h poststimulus, sterile filtered, and MMPs were quantified using the Duoset MMP-1 and MMP-3 ELISA kits (R&D Systems) according to manufacturer’s instructions. Lower limits of sensitivity for the Duoset kits are: 156 pg/ml for MMP-1 and 31.2 pg/ml for MMP-3. Samples were run with appropriate controls and at dilutions calculated to give readings within the linear range of detection as indicated by the manufacturer.

Moores R.C., Brilha S., Schutgens F., Elkington P.T, & Friedland J.S. (2017). Epigenetic Regulation of Matrix Metalloproteinase-1 and -3 Expression in Mycobacterium tuberculosis Infection. Frontiers in Immunology, 8, 602.

+ Open protocol

+ Expand

Cytokine and MMP ELISA Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

IL-6 and IL-8 ELISA kits were purchased from eBioscience, and MMP1 and MMP3 ELISA kits were purchased from R&D. Assays were performed according to the recommendations of the manufacturer.

Karonitsch T., Kandasamy R.K., Kartnig F., Herdy B., Dalwigk K., Niederreiter B., Holinka J., Sevelda F., Windhager R., Bilban M., Weichhart T., Säemann M., Pap T., Steiner G., Smolen J.S., Kiener H.P, & Superti-Furga G. (2018). mTOR Senses Environmental Cues to Shape the Fibroblast-like Synoviocyte Response to Inflammation. Cell Reports, 23(7), 2157-2167.

+ Open protocol

+ Expand

Quantifying Inflammatory Cytokines and MMPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Commercially available ELISA kits used for measuring inflammatory cytokines and MMPs were as follows: IL-6, IL-8, and IFN-γ ELISA kits from Neobioscience Technology Co, Ltd (Beijing, China); IL-17 ELISA kit from QuantoBio Biotechnology Co, Ltd (Beijing, China); TNF-α ELISA kit from eBioscience; and MMP-3 ELISA kit from R & D Systems (Minneapolis, Minnesota, USA).

Hu F., Li Y., Zheng L., Shi L., Liu H., Zhang X., Zhu H., Tang S., Zhu L., Xu L., Yang Y, & Li Z. (2014). Toll-Like Receptors Expressed by Synovial Fibroblasts Perpetuate Th1 and Th17 Cell Responses in Rheumatoid Arthritis. PLoS ONE, 9(6), e100266.

+ Open protocol

+ Expand

Quantifying Inflammatory Biomarkers via qPCR and ELISA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated with the RNeasy Mini Kit (Qiagen) and then reverse transcribed into cDNA with the Omniscript RT kit (Qiagen). RNA concentration was determined using a Nanodrop spectrophotometer. Quantitative PCR (qPCR) was performed using the Fast Start SYBR Green I kit (Roche) and the Roche Light Cycler. Results were quantified by the 2-ΔΔC(t) method, using GAPDH expression levels for normalization. Primer sequences: CXCL9 Forward: ATCAGCACCAACCAAGGGACT, Reverse: GCTTTTTCTTTTGGCTGACCTG; CXCL10 Forward: ATTTGCTGCCTTATCTTTCTG, Reverse: TCTCACCCTTCTTTTTCATTGTAG; CXCL11 Forward: GAAGGATGAAAGGTGGGTGA, Reverse: AAG CACTTTGTAAACTCCGATG; PIK3IP1 Forward: CCA GTGATTGGGATCAGCCA, Reverse: TCCCCCTCTT GTAGGAGTAGC; TNFSF18 Forward: ACGCAAGG AGGTTCAGAAGA, Reverse TCTTTGCTCCTTCAG TTGGC; GAPDH Forward: TGATGACATCAAGAAG GTGGTGAAG, Reverse TCCTTGGAGGCCATGTGGG CCAT; ELISA IL6, IL8, and CXCL10 ELISA kits were purchased from eBioscience and the MMP3 ELISA kit from R&D. ELISA were performed according to the manufacturer´s protocol.

Brandstetter B., Dalwigk K., Platzer A., Niederreiter B., Kartnig F., Fischer A., Vladimer G.I., Byrne R.A., Sevelda F., Holinka J., Pap T., Steiner G., Superti-Furga G., Smolen J.S., Kiener H.P, & Karonitsch T. (2019). FOXO3 is involved in the tumor necrosis factor-driven inflammatory response in fibroblast-like synoviocytes. Laboratory investigation; a journal of technical methods and pathology, 99(5).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!