Total RNA was extracted from monocyte lysates using PureLink RNA Mini Kit (Life Technologies) according to manufacturer’s instructions. Quantitative real-time RT-PCR was performed using the OneStep RT-PCR master mix (Qiagen Crawley, UK) according to the manufacturer’s instruction on a Stratagene Mx3000P platform (SABiosciences, Crawley, UK) using 15µg of RNA per sample. To determine the quantitative change in RNA, standard curves were prepared from a known concentration of the genes of interest and subjected to real-time PCR as above. MMP-1 primers and probes were custom made and supplied by Sigma-Aldrich (forward primer: 5’- AAGATGAAAGGTGGACCAACAATT -3’; reverse primer: 5’-CCAAGAGAATGGCCGAGTTC-3’; probe: 5’- FAM-CAGAGAGTACAACTTACATCGTGTTGCGGCTC-TAMRA-3’) and 18S rRNA primer and probe mix was supplied by Life Technologies.
18s rrna primer and probe mix
Manufactured by Thermo Fisher Scientific
The 18S rRNA primer and probe mix is a set of oligonucleotides designed for the detection and quantification of the 18S ribosomal RNA (rRNA) gene. The 18S rRNA gene is a commonly used target for various molecular biology applications, including gene expression analysis, environmental monitoring, and pathogen detection. This product provides the necessary components for performing real-time PCR (qPCR) or reverse transcription-qPCR (RT-qPCR) assays targeting the 18S rRNA gene.
Automatically generated - may contain errors
2 protocols using 18s rrna primer and probe mix
1
Quantitative Real-Time RT-PCR for MMP-1 Expression
2
Quantitative RT-PCR analysis of MMP-1 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from monocyte lysates using PureLink RNA Mini Kit (Life Technologies) according to the manufacturer’s instructions. Quantitative real-time RT-PCR was performed using the OneStep RT-PCR Master Mix (Qiagen, Crawley, U.K.) according to the manufacturer’s instruction on a Stratagene Mx3000P platform (SABiosciences, Crawley, U.K.) using 15 μg of RNA per sample. To determine the quantitative change in RNA, standard curves were prepared from a known concentration of the genes of interest and subjected to real-time PCR as above. MMP-1 primers and probes were custom made and supplied by Sigma-Aldrich (forward primer: 5′-AAGATGAAAGGTGGACCAACAATT-3′; reverse primer: 5′-CCAAGAGAATGGCCGAGTTC-3′; probe: 5′-FAM-CAGAGAGTACAACTTACATCGTGTTGCGGCTC-TAMRA-3′), and 18S rRNA primer and probe mix was supplied by Life Technologies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!