Control mirna mimics

Full length of ZFAS1 or adaptor-associated kinase 1 (AAK1) sequence was synthesized by RiboBio (Guangzhou, China) and inserted into the pcDNA3.1 vector (V79020; Invitrogen, CA, USA) to generate pcDNA/ZFAS1 or pcDNA/AAK1. The miR-4711-5p mimics (UGCAUCAGGCCAGAAGACAUGAG), control miRNA mimics (NC mimics; AAACACUUCAAGAGGGGUCCAUA), as well as shRNA targeting ZFAS1 (sh-ZFAS1; GAATATATATATACATATA) and scrambled control (sh-NC; TATATGTATATATATATTC) were obtained from RiboBio (Guangzhou, China). NP cells were seeded into 24-well plates at 1 × 10⁷ cells/well, and then 2 µg vectors or 50 nM synthetic oligonucleotides were transfected into NP cells. Transfection was performed by using Lipofectamine 2000 (11668; Invitrogen) according to the manufacturer’s protocol [19 (link),20 (link)].

The miR-124 mimics (miR10000134), control miRNA mimics (MIMAT0000295), miR-124 inhibitor (miR20000134), and control inhibitors (MIMAT0000039) were synthesised by RiboBio (Guangzhou, China) and were transfected into BV2 cells by using riboFECT™ CP (RiboBio) according to the manufacturer’s protocol. The miRNA-124 mimic sequence was 5′-CCGUAAGUGGCGCACGGAAU-3′. The miR-124 inhibitor sequence was 5′-GGCAUUCACCGCGUGCCUUA-3′. In addition, the small interfering RNA (siRNA) specifically targeting MEKK3 (MEKK3 siRNA) and the control siRNA (siNC) were purchased from Shanghai GenePharma (A10001; Shanghai, China). MEKK3 siRNA and siNC were transfected with Lipofectamine 2000 Reagent (11668019; Invitrogen, USA) according to the manufacturer’s instructions. The sense strand of the MEKK3 siRNA was 5′-GGAGAGACGAAUUAUAGCATT-3′, and the antisense strand was 5′-UGCUAUAAUUCGUCUCUCCTT-3′. The recommended concentrations are as follows: miR-124 mimics (50 nM), miR-124 inhibitor (100 nM), and MEKK3 siRNA (100 nM).