Gene images alk phos direct labelling and detection system

For each cell line generated, approximately 5 μg of genomic DNA was digested overnight with the AvaI and BamHI and separated by electrophoresis in 0.8% agarose gels. The gel was washed for 10 min in 0.25 M HCl, rinsed in distilled water then washed with denaturation buffer (1.5 M NaCl, 0.5 M NaOH) for 15 to 30 min before being rinsed again with distilled water. Finally, the gel was washed with neutralization buffer (3 M NaCl, 0.5 M Tris-HCl, pH 7.0) for 30 min and rinsed with distilled water. DNA was transferred overnight to a Hybond N nylon membrane (GE Healthcare) by capillary force in 20× SSC buffer (3 M NaCl, 0.3 M sodium citrate, pH 7.0). After the transfer, the membrane was washed for 10 min in 2× SSC buffer and the DNA was crosslinked to the membrane in a UV Stratalinker 2400 crosslinker (Stratagene) at 1200 mJ. For the probing, the Gene Images Alk-Phos Direct Labelling and Detection System (GE Healthcare) was used, according to the manual, to generate a fluorescent-labeled DNA probe. The 5’ flanking region of ISP2, digested out of the respective plasmid and purified from agarose gel, was used as a probe. Signal was detected using CDP-Star detection reagent (GE Healthcare).

PCR fragment of the gene of interest was inserted into the pDrive vector (QIAGEN, Valencia, CA, USA), sequenced, and thereafter used as template for making probe with the Gene Images AlkPhos Direct Labelling and Detection System (GE Healthcare). For PVY probe, three fragments (inserts) including the P1 (nt 1–~1100), P3 (nt ~2100–~3300) and the CP (nt ~8500–9700) obtained from PVY^N:O-Mb112 [19 (link)] pooled and labelled. Potato aminocylcopropane-1-carboxylic acid (ACC) oxidase gene 1 (ACO1) (accession number AF384820) [27 (link)] was used as a probe for the ACO gene. A 990 bp tobacco heat-shock protein 90 (Hsp90) (accession number GQ845021) amplified by 5'GTTTGACTGACAAGAGCAAGCT3' (sense) and 5'GGATCTTGTTCTGCTGCAA3' (antisense), and a tobacco PR-1a (accession number X06930) fragment of 760 bp amplified with primers 5'TCTCTTTTCACAATTGCCTTCA3' (sense) and 5'AGACCATCAACACATGATTCG3' (antisense) were used as probes for their corresponding genes after confirmation by cloning and sequencing.

For each cell line generated, approximately 5 μg of genomic DNA was digested overnight with the StuI and SphI and separated by electrophoresis in 0.8% agarose gels. The gel was washed for 10 min in 0.25 M HCl, rinsed in distilled water then washed with denaturation buffer (1.5 M NaCl, 0.5 M NaOH) for 15 to 30 min before being rinsed again with distilled water. Finally, the gel was washed with neutralization buffer (3 M NaCl, 0.5 M Tris-HCl, pH 7.0) for 30 min and rinsed with distilled water. DNA was transferred overnight to a Hybond N nylon membrane (GE Healthcare, Little Chalfont, UK) by capillary force in 20× SSC buffer (3 M NaCl, 0.3 M sodium citrate, pH 7.0). After the transfer, the membrane was washed for 10 min in 2× SSC buffer and the DNA was crosslinked to the membrane in a UV Stratalinker 2400 crosslinker (Stratagene, La Jolla, CA, USA) at 1200 mJ. For the probing, the Gene Images Alk-Phos Direct Labelling and Detection System (GE Healthcare Little Chalfont, UK) was used, according to the manual, to generate a fluorescent-labeled DNA probe. The 5′ flanking region of ICP or the open reading frame (ORF) of ICP, digested out of the respective plasmid and purified from agarose gel, were used as probes. The signal was detected using CDP-Star detection reagent (GE Healthcare).